Busch Lab

ZMP

ENSDARG00000076310

Ensembl ID:
ENSDARG00000076310
Human Orthologue:
FBXO41
Human Description:
F-box protein 41 [Source:HGNC Symbol;Acc:29409]
Mouse Orthologue:
Fbxo41
Mouse Description:
F-box protein 41 Gene [Source:MGI Symbol;Acc:MGI:1261912]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa6754 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa6754
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109077 Nonsense 419 669 10 17
Genomic Location (Zv9):
Chromosome 23 (position 45945841)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 45865339
GRCz11 23 45600534
KASP Assay ID:
554-5356.1 (used for ordering genotyping assays)
KASP Sequence:
CTCAGTGGTGCAGTCAGACTCAGTGTCTCGTTCTTCAGAACCTYAAACCA[C/T]GAGCTCGAGCCAAGAAAGAAAGCAAAGACGAGTACATCCGRAGCACCAGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa6753
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109077 Nonsense 665 669 17 17
Genomic Location (Zv9):
Chromosome 23 (position 45940036)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 45871144
GRCz11 23 45606339
KASP Assay ID:
554-4900.1 (used for ordering genotyping assays)
KASP Sequence:
TTGTWCTCCYGCAGGYGTTGAGAAARAGACCCGGCCTGTGTRACGTYCTT[C/T]AGATCAAAGTGGACAAACCCTGAAAATACACGTTACTGTGACARTCTGAT
Associated Phenotype:
Not determined