Busch Lab

ZMP

si:ch211-141h12.1

Ensembl ID:
ENSDARG00000076309
ZFIN ID:
ZDB-GENE-081104-119
Human Orthologue:
MXRA5
Human Description:
matrix-remodelling associated 5 [Source:HGNC Symbol;Acc:7539]

Alleles

There are 12 alleles of this gene:

Allele Name Consequence Status Availability
sa41561 Nonsense Mutation detected in F1 DNA Not yet available
sa9164 Nonsense Mutation detected in F1 DNA Not yet available
sa1691 Nonsense Available for shipment Available now
sa9588 Nonsense Available for shipment Available now
sa27514 Nonsense Mutation detected in F1 DNA Not yet available
sa41562 Nonsense Mutation detected in F1 DNA Not yet available
sa21620 Nonsense Available for shipment Available now
sa34797 Nonsense Mutation detected in F1 DNA Not yet available
sa31754 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41561
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110561 Nonsense 77 2520 2 8
ENSDART00000144757 None None 967 None 3
ENSDART00000147209 Nonsense 68 652 2 4
Genomic Location (Zv9):
Chromosome 9 (position 57757482)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 56189025
GRCz11 9 55539566
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAGATTTAACACCATCAGTCAGATCACAGACGCCTCTTTCAGTGGCCTT[C/T]GAAAGCTGGAGCTGCTGATGATGCACGGGAACAACGTGCAGAAGATACCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5578
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site, Missense, Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110561 Missense, Splice Site 105 2520 3 8
ENSDART00000144757 None None 967 None 3
ENSDART00000147209 Essential Splice Site 96 652 None 4
Genomic Location (Zv9):
Chromosome 9 (position 57761235)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 56192778
GRCz11 9 55543319
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATTGTAAAGTCTGACCATAATGACTCTTGTTTTCTCCTGTTTCTTTCTGC[A/T]GGTTTTAAAAATGAGCTACAATAAGCTGACAGTCATCACCGATCGCACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9164
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110561 Nonsense 233 2520 3 8
ENSDART00000144757 None None 967 None 3
ENSDART00000147209 Nonsense 223 652 3 4
Genomic Location (Zv9):
Chromosome 9 (position 57761618)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 56193161
GRCz11 9 55543702
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACCCCWGGAGCTGTGACTGCCGCATGCGCTGGCTGCAGGACTGGAGCGCT[C/T]GACATCCAGGTCAGACATGATCATATTGTAATGGCGATCTWYTTCTTYAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1691
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110561 Nonsense 716 2520 4 8
ENSDART00000144757 None None 967 None 3
ENSDART00000147209 None None 652 None 4
Genomic Location (Zv9):
Chromosome 9 (position 57763866)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 56195409
GRCz11 9 55545950
KASP Assay ID:
554-1637.1 (used for ordering genotyping assays)
KASP Sequence:
TAACACCGACTCGAAGAAGGCGTCCAAATRCACGTAGGTTTGGGAACATT[C/T]GACATAGACGGCCCTTTAGGAACAGAGCTGGTTTACCAAACCAAAGACCA
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa9588
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110561 Nonsense 1006 2520 5 8
ENSDART00000144757 None None 967 None 3
ENSDART00000147209 None None 652 None 4
Genomic Location (Zv9):
Chromosome 9 (position 57764803)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 56196346
GRCz11 9 55546887
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CMAAGTGAAGGAAAGTAACTTCCAACAAACTCAGCAAGTGATGCCAAACT[C/A]GAGGYTTCACCCCACAATAKCAACAAATGYATCTGCGGTTTTGAGGTTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27514
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110561 Nonsense 1141 2520 5 8
ENSDART00000144757 None None 967 None 3
ENSDART00000147209 None None 652 None 4
Genomic Location (Zv9):
Chromosome 9 (position 57765207)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 56196750
GRCz11 9 55547291
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAGAGAGGGTGTTACTTCTACTGAAGAGTCTGTAGTCTCCTCCATACTA[C/T]AATCTCAAACCTATCCTCTTTCAAACCCAAATCAAAGCTTCAAAGAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41562
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110561 Nonsense 1387 2520 6 8
ENSDART00000144757 None None 967 None 3
ENSDART00000147209 None None 652 None 4
Genomic Location (Zv9):
Chromosome 9 (position 57765975)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 56197518
GRCz11 9 55548059
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACAACCAGACTTGGATTCTAAGGTGGGCCAAAGGAACAGATTAATCCCC[G/T]AACTTGAACTTACAACATCAGTTAACACTCCACCTGCAACTACCAGCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21620
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110561 Nonsense 1470 2520 6 8
ENSDART00000144757 None None 967 None 3
ENSDART00000147209 None None 652 None 4
Genomic Location (Zv9):
Chromosome 9 (position 57766226)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 56197769
GRCz11 9 55548310
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCAGGAACAAACTACATAGGGGGAAGAATTCCTAGTACTAATCATAGGTA[T/G]CCATACTATCACAGTAGAAATATTAAACCCAATATTGACAGAACGCCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34797
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110561 Nonsense 1473 2520 6 8
ENSDART00000144757 None None 967 None 3
ENSDART00000147209 None None 652 None 4
Genomic Location (Zv9):
Chromosome 9 (position 57766235)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 56197778
GRCz11 9 55548319
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACTACATAGGGGGAAGAATTCCTAGTACTAATCATAGGTATCCATACTA[T/G]CACAGTAGAAATATTAAACCCAATATTGACAGAACGCCATCTCTGACCAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3725
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110561 Nonsense 1619 2520 7 8
ENSDART00000144757 Nonsense 66 967 2 3
ENSDART00000147209 None None 652 None 4
Genomic Location (Zv9):
Chromosome 9 (position 57768480)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 56200023
GRCz11 9 55550564
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AATGGCACTTTTACCATYAGAAACGTCCATCTTCAGGACCGCGGTCAGTA[T/A]CTCTGCAGCGCTAGCAATGCTCACRGCACAGATAAGATGATGGTGACGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31754
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110561 Nonsense 1656 2520 7 8
ENSDART00000144757 Nonsense 103 967 2 3
ENSDART00000147209 None None 652 None 4
Genomic Location (Zv9):
Chromosome 9 (position 57768591)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 56200134
GRCz11 9 55550675
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTCACGTTCCCAGGATGACGAGTCCACGCCATCAAGACGTAACGGTGTA[T/A]ATAGGAAACACTGCACTCCTGCAATGCCAAGCACAAGGACTCCCAATCCC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27515
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110561 Nonsense 1894 2520 8 8
ENSDART00000144757 Nonsense 341 967 3 3
ENSDART00000147209 None None 652 None 4
Genomic Location (Zv9):
Chromosome 9 (position 57770768)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 56202311
GRCz11 9 55552852
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATCTATCTCTATATTGGTGATTTCAGCTTTGACCGCAGAATGAAGGTGT[T/A]GTCTAACGGCACTCTCACCATCACATCAGTGACCGAGCAGGACGAGGGCG
Associated Phenotype:
Not determined