Busch Lab

ZMP

calrl2

Ensembl ID:
ENSDARG00000076290
ZFIN ID:
ZDB-GENE-030131-4042
Description:
calreticulin [Source:RefSeq peptide;Acc:NP_956007]
Human Orthologue:
CALR
Human Description:
calreticulin [Source:HGNC Symbol;Acc:1455]
Mouse Orthologue:
Calr
Mouse Description:
calreticulin Gene [Source:MGI Symbol;Acc:MGI:88252]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa17516 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17516
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101655 Nonsense 197 417 5 9
Genomic Location (Zv9):
Chromosome 8 (position 17107311)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 16552199
GRCz11 8 16587911
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAACACATATGAAGTCAAGATTGATAATAAGAAGGTCGAATCWGGATCTT[T/A]GGAAGAAGACTGGGACTTYYWGCCTTCCAAAAAGAYCWAAGATCCCGAAG
Associated Phenotype:
Not determined