Busch Lab

ZMP

KCNH7 (1 of 2)

Ensembl ID:
ENSDARG00000076281
Description:
potassium voltage-gated channel, subfamily H (eag-related), member 7 [Source:HGNC Symbol;Acc:18863]
Human Orthologue:
KCNH7
Human Description:
potassium voltage-gated channel, subfamily H (eag-related), member 7 [Source:HGNC Symbol;Acc:18863]
Mouse Orthologue:
Kcnh7
Mouse Description:
potassium voltage-gated channel, subfamily H (eag-related), member 7 Gene [Source:MGI Symbol;Acc:MGI

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa31750 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa31750
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114016 Essential Splice Site 166 253 2 3
Genomic Location (Zv9):
Chromosome 9 (position 52445888)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 51077498
GRCz11 9 51090206
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATATTTCCAGCATTCCTGGACCTACACCAACGGCATCGACATGAACATG[G/A]TGCGTCTACTCACTGTAATTACTGACAACACTGTAAAAACACTGTAGCTA
Associated Phenotype:
Not determined