Busch Lab

ZMP

adamts13

Ensembl ID:
ENSDARG00000076270
ZFIN ID:
ZDB-GENE-070814-7
Description:
Novel protein similar to vertebrate ADAM metallopeptidase with thrombospondin type 1 motif, 13 (ADAM
Human Orthologue:
ADAMTS13
Human Description:
ADAM metallopeptidase with thrombospondin type 1 motif, 13 [Source:HGNC Symbol;Acc:1366]
Mouse Orthologue:
Adamts13
Mouse Description:
a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 13 Gene

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa5819 Nonsense F2 line generated Not yet available
sa16863 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa5819
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110085 None None 1332 None 32
ENSDART00000110310 Nonsense 705 1318 20 33
ENSDART00000142300 None None 357 None 9
ENSDART00000146364 None None 400 None 9
Genomic Location (Zv9):
Chromosome 8 (position 47273256)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 45241957
GRCz11 8 45249836
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCAAATAAACACAGGTTATCAGCTCCTTTAACATCTTCACAATGCACCTG[C/A]ACTCTGGACAGATGCTGTCTTTAAGGCCGTACTCACACTAGGYACAGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16863
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110085 Essential Splice Site 1159 1332 29 32
ENSDART00000110310 Essential Splice Site 1152 1318 30 33
ENSDART00000142300 None None 357 None 9
ENSDART00000146364 None None 400 None 9
Genomic Location (Zv9):
Chromosome 8 (position 47288415)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 45226798
GRCz11 8 45234677
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGAGGTYATTCAAATCARAATTATTTCCAGTACCCTTAACTGCCAGCAAA[G/A]TAAGTGCTAATCTTTCATTGCTTACAGACAGGGGAATCTGTAATAGCATG
Associated Phenotype:
Not determined