Busch Lab

ZMP

MYOCD

Ensembl ID:
ENSDARG00000076267
Description:
myocardin [Source:HGNC Symbol;Acc:16067]
Human Orthologue:
MYOCD
Human Description:
myocardin [Source:HGNC Symbol;Acc:16067]
Mouse Orthologue:
Myocd
Mouse Description:
myocardin Gene [Source:MGI Symbol;Acc:MGI:2137495]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa24898 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa24898
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104925 Essential Splice Site 335 788 9 15
Genomic Location (Zv9):
Chromosome 12 (position 215401)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 208119
GRCz11 12 156816
KASP Assay ID:
554-7458.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAGCCCCGTCCGGCCCGCACCGCTGCCCACCAACCTGGATGACCTGAAG[G/A]TGACAGCGCACACACACACGCACACACACACCTGAATCTGAAGAGCGTGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27844
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104925 Nonsense 427 788 10 15
Genomic Location (Zv9):
Chromosome 12 (position 216420)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 207100
GRCz11 12 155797
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCCTCTGATCTCTCCATCAGCGCAGACAGCTTCAGCGACGCCACCGTAT[C/A]ACCGTTCGGCACGCAGCCGTCTCCGGCACACACTGAACACACACCGGACG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27845
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104925 Nonsense 470 788 11 15
Genomic Location (Zv9):
Chromosome 12 (position 217136)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 206384
GRCz11 12 155081
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGTCAGGTGATCGAGGAGCTGATGTGGCGGCTGCAGCAGGAGCAGCGG[C/T]AGGTGGAGGAGCTGCGCACACAACTGCACAGGCGGAGGCTGGAGCCGCAC
Associated Phenotype:
Not determined