Busch Lab

ZMP

atp10a

Ensembl ID:
ENSDARG00000076230
Human Orthologue:
ATP10B
Human Description:
ATPase, class V, type 10B [Source:HGNC Symbol;Acc:13543]
Mouse Orthologue:
Atp10b
Mouse Description:
ATPase, class V, type 10B Gene [Source:MGI Symbol;Acc:MGI:2442688]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa22466 Essential Splice Site Available for shipment Available now
sa16204 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22466
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113676 Essential Splice Site 205 1294 2 21
Genomic Location (Zv9):
Chromosome 14 (position 23319309)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 22019099
GRCz11 14 22316344
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAAACCAACCTCAAGCAGAGAAAGGTGGTGCCAGGCTTCTCTACTCTGG[T/C]AAGGGCAACGAGCGACAAAATATCTGTGCTAAAGATCATAAAGTTATGGT
Long Flanking Sequence:
GACTTCATCAGATGTTTAGATTTTTGTGATTATAAATGTAGACAATCGAACACATATTAAATTAAATAATGTCTTAATAACGTTTTTGCAATGTAATTAAAAAAACTTTACATTAAAAAAGTTTTTTTAATTTAATTAATCACAAGGGAAAGTATTCACTAGTAGTTTCTTGCCTTAATAGAAAGCTAATGTTGTACTGTGCTGTGTTCATAAGCATAAGCCTTTATGTGACTCTGAAAGACCACAGTGTATCATTAGAGGTCCGTCTGAGGTATTAATTCTGCTCTTCTGCAGGAGGCTGATGTGTTTCGTGGAGAGGCGCTGGAAGGATGTTCGGGTGGGGGACTTTGTGAAAGTGCTCTCTAATGAAATCATCCCAGCAGATATCCTGCTCCTGCACACGTCCGACCCCAATGGAGTGTGTCATATGGAGACTGCAAATCTGGATGGAGAAACCAACCTCAAGCAGAGAAAGGTGGTGCCAGGCTTCTCTACTCTGG[T/C]AAGGGCAACGAGCGACAAAATATCTGTGCTAAAGATCATAAAGTTATGGTGGGCCCATTAAGATATCGATGAGATAAAATAATGCCAAGATCTTTTTTAAAAGACAAATAAGCATGCTCTCCCTGCCAATACCTATCTTGTAACACCAAAATAGTTGCTGTAATTGGGCTTTAGTTTAAAAAAAAAAAAAAAAAAAAAAATACATACAGACAGTAGCACACTCGCCTCTCATCAAGAAGGTTGCTGGTTCGAGCCCAGGCTGGGCCAGTTGGCATTTCTGGGTGGAGTTTGTATTTTCTCCCCTTGTTTGCGTGGGTTTCCTCTGGGTACTCCAGTTTCCCCCACAGTCCAAAGACATTGGGTAAGCTTAAATTGTCCATAGTGTATGTGTGTGAATGAGTGTGTATGGATGTTTCCCAGTGATAAGTTGCAGCTGGAAGGGCATCCTCTATGTAAAAACATATGCTGGATAAGTTGTTGGCTCATTCCGCTGTGGCGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16204
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113676 Essential Splice Site 741 1294 11 21
Genomic Location (Zv9):
Chromosome 14 (position 23343151)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 22042941
GRCz11 14 22340186
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGAAYGAGCCTATGYTGCKAKTGTCATTTGTTTTCYACAAATATGTCACC[A/T]GTTGAAAGTGCAGCGAAGCGAATTGCTGTGAGAACTCAAAAAGACCTTGA
Long Flanking Sequence:
CAAAAGCACTGATTGACCCACCCACTCACTTCCGTAAATCCAACCAAAAGTTGTAAAAAGCAATCCAAAAAAAAAACAGGTCCTCGCCTAATTTTTACCATGTTTTTTAGATTTTACCACATTCTCACCCTGTTATTTACTTGTTTATTTTATTTTTTTGGCTTCTGTTTTTGTCTTACCTGCTTTCTGGAACCGTTCTTTACCGGACTCAAACCTCGTCGTTGTGGTCAACTCCTCAATGCGTCTCAAGTCTGCCGATATACATGAAGAGCTAACTGTACAAACGGGTTTAAGCAGGAAAGCCGTCAAGGTCAGCTGGTCAGCTGAAAAGCAAGAAAAGGAACGGCTTCATACTGCACCATAGCTTTTGTTTTAAAACAAAATGCAGCCATACATAGCGCTGGCTACATAATTTTTGATCTCCAGAAATGTATATTGGGCTATGTTTTCAGAACGAGCCTATGTTGCGAGTGTCATTTGTTTTCCACAAATATGTCACC[A/T]GTTGAAAGTGCAGCGAAGCGAATTGCTGTGAGAACTCAAAAAGACCTTGACATGTACGCCAGGGATGGATTACGAACACTGTGCTTTGCCAAAAAGGTAAAGTTTTGGTTGGAAAATTATACATTAAAACCAACTATATTTGAAAACTGCTTAATAGTCTTGCTGGATTATTCTCTAAAGGTTATCAGTGAACAGGAGTTCAAGGCCTGGTTTACTAGCAGACAAGAGGCTTTGTCAGCCATCGATGAGAAAGAAGAACGCCTCATGGAGACCGCAAATGACATTGAGAACAACCTCACTCTATTGGGTATAATCTCTGCTCCCTTCATTGATATTACAATGCACTTATCCTTTACACTTTGAGTTAATATTTAATCTAGATATTTTTGCAAGCAACTTGTTCAGGTTAATTTATTTGTTCAGTACAAAATTAAAAAATAAATTCTATCTTAAGCCTAACTTTAAAAAAAAATTTAGTTAAGTGTTTTCAGGTAATAGGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28302
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113676 Nonsense 875 1294 13 21
Genomic Location (Zv9):
Chromosome 14 (position 23345073)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 22044863
GRCz11 14 22342108
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTGCAAGCTGCTGGACCATGAAGACCTGGTGTTCACTTTCACCACAAAC[A/T]AGAAGGTATCTGATCTGGCTGATTCAATGCCAGCTAACTAATGCTTTTAC
Long Flanking Sequence:
AAAAACCTTGTAATAAATTGCCAGTACAGTTTCTTTTATATTACAGACTTATTTCTTTATACATTATTACTTATACATTATATTATTTAAAACTACTAAAATGTCAATAAAAGTCACTTTGTTAGAGTTTTTTTAATTTTTTTATTTTTAACATTAAAAGTCATCAGAGCAGAGATCTAGGTCCTATAATGCAACTGTAAGTAAGCAACACAAAACAGTAAACTGTTAATTAACAGATATATTTTAGTGTAACTTTCAAAGTCAATTCTATGGTAAGCATCTTCACAGTTTGGTGACATGATCTAACTTGTGTACCCACAGGGGCCACTGGCATTGAAGATCGGCTCCAAGAAAACGTCCCAGAAACAATTCAGGCTCTGAGACGGGCTGGCATGCAGGTTTGGGTGCTGACAGGAGACAAACCCGAGACGGCTGTCAACATCGCTTACTCCTGCAAGCTGCTGGACCATGAAGACCTGGTGTTCACTTTCACCACAAAC[A/T]AGAAGGTATCTGATCTGGCTGATTCAATGCCAGCTAACTAATGCTTTTACAATGTTGTTCCTAACAAAGACTTGGCCTCTGTTAGTCAACCAGCTTCATCAGAAGAATTATTTAACGTATGACATTAAAGTGCCCCATAATGCTTTTCGAATGTTACCTTCATATAGGGTGAGATGTAGCTGTTTGTGATTGTGACAGGTCTAAAAAAATGGAAGAGTATAAATAAATGCAGTTGTTTGCACAGAAATGTAAAAAAATAATTATTATTTAACCTCTAAAACATCCTTTATATTTGGATAAAATATTATTTTTATTTATATTATTTTAATTTAATTATTATATAATATTAATAATTTAATAATACATGAATAATAAATTGAGAGTTGTGAACAAAACAATTGATTGTGGCGTATACTTCACAAAGAAGAAATAAAAATATTTTTTCTCACAATTTAAGTATATTTGCAATGGCAAGGTAATTGACCCACCCTTTATATAAA
Associated Phenotype:
Not determined