Busch Lab

ZMP

si:zfos-692b10.1

Ensembl ID:
ENSDARG00000076212
ZFIN ID:
ZDB-GENE-091113-27
Human Orthologue:
RPS6KC1
Human Description:
ribosomal protein S6 kinase, 52kDa, polypeptide 1 [Source:HGNC Symbol;Acc:10439]
Mouse Orthologue:
Rps6kc1
Mouse Description:
ribosomal protein S6 kinase polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:2443419]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa43370 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa12395 Essential Splice Site Available for shipment Available now
sa43369 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa43370
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115220 Essential Splice Site 125 929 4 18
ENSDART00000146937 None None 746 None 10

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 3309288)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 3252942
GRCz11 20 3270443
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTAATATTCCTGCTTTATATGGCAGTTCATACATTCAAGATTTCTTTAAG[G/A]TATGTTTGTATTTATTTATTTATTTATTTATTTATTTATTCCAAGGCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12395
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115220 Essential Splice Site 156 929 5 18
ENSDART00000146937 None None 746 None 10

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 3304889)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 3248543
GRCz11 20 3266044
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACCCTTTTCTGATTTTCTAGCTGAYAGYCTGTTAGACAGCAGTTCTGAAG[G/A]TARGTCTCTACACTATTTATTGCTCACAGGTTTATGTATTGCTCCCCACA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7926
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115220 Essential Splice Site 359 929 11 18
ENSDART00000146937 Essential Splice Site 180 746 4 10
Genomic Location (Zv9):
Chromosome 20 (position 3282476)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 3236338
GRCz11 20 3253839
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGGTGCTGTTGGTRATGGATAATAGAACACAGGAAACCTTTATTTTGAAA[G/A]TAAGTGGGACACAGAGGTCGCGTTAACCGAATATTTTCCKTCATTGACGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43369
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115220 Nonsense 581 929 13 18
ENSDART00000146937 Nonsense 402 746 6 10
Genomic Location (Zv9):
Chromosome 20 (position 3278011)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 3231873
GRCz11 20 3249374
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGATAGAAATGATGCCTGTACGGCACTGTTACCTTCGGATGCTGATGTC[G/T]AGGTCTTAGAGGAGCCCCTGCAGAAGCCACAGGTTGTGTCAGATCTCTGG
Associated Phenotype:
Not determined