Busch Lab

ZMP

FBXL13

Ensembl ID:
ENSDARG00000076191
Description:
F-box and leucine-rich repeat protein 13 [Source:HGNC Symbol;Acc:21658]
Human Orthologue:
FBXL13
Human Description:
F-box and leucine-rich repeat protein 13 [Source:HGNC Symbol;Acc:21658]
Mouse Orthologue:
Fbxl13
Mouse Description:
F-box and leucine-rich repeat protein 13 Gene [Source:MGI Symbol;Acc:MGI:2443416]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa44274 Nonsense Mutation detected in F1 DNA Not yet available
sa17674 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa44274
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111425 Nonsense 138 767 5 21
Genomic Location (Zv9):
Chromosome 25 (position 19267490)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 18679467
GRCz11 25 18777418
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGATGAAGGCTGCCCGGCTCCTTGAAAGAATGGAGGAGGCTGAGATGTA[T/A]CACACACAGAGAAGGATAAAACTGGCTTTCATAAAGTGGACAGCATGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17674
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111425 Essential Splice Site 200 767 6 21
Genomic Location (Zv9):
Chromosome 25 (position 19265251)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 18677228
GRCz11 25 18775179
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTTGGCGTCATGTTGTGCAGGACRCTAAAAGAACAAAGGAATACTTTAAG[G/A]TATAATTATTAAAACARTCARCTAAACCCAAATGCATTGAATTCAWGAGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1399
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111425 Essential Splice Site 689 767 19 21
Genomic Location (Zv9):
Chromosome 25 (position 19258980)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 18670957
GRCz11 25 18768908
KASP Assay ID:
554-1311.1 (used for ordering genotyping assays)
KASP Sequence:
CCTTCTTCTGCAGGACCATTGCCACTGTCAGAATAGCTGGATGCCCCAAA[G/T]TACTTCTTTTATTCAGCCATTTTTAAACTATGTCTGAAATAAAGGTATGA
Associated Phenotype:
Not determined