Busch Lab

ZMP

ENSDARG00000076160

Ensembl ID:
ENSDARG00000076160

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa26329 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa26329
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110319 None None 125 None 2
ENSDART00000112071 Nonsense 204 605 4 11
Genomic Location (Zv9):
Chromosome 4 (position 34499793)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 40295093
GRCz11 4 40836956
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGACCCCACTGAGCCAAACTTGATGTTTGTTCGGCGGGTGGAAAAAGTG[C/T]GAGAGTACTTTAACATCTTGTCAGATACAAATCTCTCAAAATGGACAGTG
Associated Phenotype:
Not determined