Busch Lab

ZMP

si:dkey-241o6.2

Ensembl ID:
ENSDARG00000076153
ZFIN ID:
ZDB-GENE-090313-268
Human Orthologues:
LCA5, LCA5L
Human Descriptions:
Leber congenital amaurosis 5 [Source:HGNC Symbol;Acc:31923]
Leber congenital amaurosis 5-like [Source:HGNC Symbol;Acc:1255]
Mouse Orthologues:
Lca5, Lca5l
Mouse Descriptions:
Leber congenital amaurosis 5 (human) Gene [Source:MGI Symbol;Acc:MGI:1923032]
Leber congenital amaurosis 5-like Gene [Source:MGI Symbol;Acc:MGI:3041157]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa9927 Essential Splice Site Available for shipment Available now
sa37755 Nonsense Mutation detected in F1 DNA Not yet available
sa11604 Nonsense Available for shipment Available now
sa1415 Missense, Nonsense Available for shipment Available now
sa10874 Missense, Nonsense Available for shipment Available now
sa6746 Nonsense Mutation detected in F1 DNA Not yet available
sa37754 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29966
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112619 Nonsense 204 753 2 7
ENSDART00000132736 Nonsense 204 460 3 8
Genomic Location (Zv9):
Chromosome 23 (position 31629681)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 31464571
GRCz11 23 31391102
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGTTTACTGCGACAGCTGCAGCTCCGGCAAGAGAAAGCTTTGCACCGTTA[C/A]AATGACACGGACAGCGAGATCTCACAGCTGCTGGCTCGTCACAACAATGA
Long Flanking Sequence:
GGAAAAATATACAGGGGGCTAATAATTCAGGAGGGCTGATAATTCTGACTTAAACTGTATATATGTATGTGTATGTTTATGTATGCATGTATGTATGTATGCATGCATGCATGAATGTATGTGTGTGTGTGTGTGTGTGTCTGTGTGTATATATATCTAAACTTACAAGTTTATCTATCTTGAAATTCTTTATTCAACAGTGTTTACCTATATTTGTTGTTTCTTACAGGTGTGCACAAAGGTGCATCTCGCCGTATCCTGTCCCACTCCCATCATCCTCAGCAACGAGCAGGAGCAATCCGATCCCAAAGTTTGAGCAAAGACGCTCCATCCAAAGAAGTGGACCAGGTCACTAAACGCATGCTGTCAGCACGTCTACTAAAGATCAACGAGTTGAAGAACGCGTTGTCTGAGCTGAGGCTGCATGCGGACGAGCTGCAGCGAGAGAACCGTTTACTGCGACAGCTGCAGCTCCGGCAAGAGAAAGCTTTGCACCGTTA[C/A]AATGACACGGACAGCGAGATCTCACAGCTGCTGGCTCGTCACAACAATGAAACTCACGTGCTGCGCGAGAGATTGAGACGCAGTCAAGAGAACCAACGCACAGCTGAGCGCAGCCTCAGGGAAAGAGACGCTCAGCTCCAGCGCTGCCGCAGTCAAATGCAGAAGCTGCAACAACTCGCAGATGACCAGAATCTTGGAGAGAGAGAGGAACTCTCGCGAAAACTAATTGGCACTCAAAGCAGATTGCAAGATAGTGAACACAGAGTGAAGGTAAAAACATTTAAAAAACTAACTAACTAAGTATAGCAATGTCTTGCTTAATTTGTAAATGAATAATTCCCAGAACAAATCCAGGGAATAAAAGTTACTGTGACCGACGTCCACCAAACGATTTCAGTTTTCCTGGAACATGACATCATTAAACGGTGATACTAAATGGTCTTTAATTATTTTGTGCCATTTAATGTTATAGGTCAGTCATGGTTAATAAAAACAAGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9927
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112619 Essential Splice Site 294 753 2 7
ENSDART00000132736 Essential Splice Site 294 460 3 8
Genomic Location (Zv9):
Chromosome 23 (position 31629409)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 31464299
GRCz11 23 31390830
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACTAATTGGCACTCAAAGCAGATTGCAAGATAGTGAACACAGAGTGAAGG[T/C]AAAAACATTTAAAAAACTAACTAACTAAGTATAGCAATGTCTTGCTTAAT
Long Flanking Sequence:
TCATCCTCAGCAACGAGCAGGAGCAATCCGATCCCAAAGTTTGAGCAAAGACGCTCCATCCAAAGAAGTGGACCAGGTCACTAAACGCATGCTGTCAGCACGTCTACTAAAGATCAACGAGTTGAAGAACGCGTTGTCTGAGCTGAGGCTGCATGCGGACGAGCTGCAGCGAGAGAACCGTTTACTGCGACAGCTGCAGCTCCGGCAAGAGAAAGCTTTGCACCGTTACAATGACACGGACAGCGAGATCTCACAGCTGCTGGCTCGTCACAACAATGAAACTCACGTGCTGCGCGAGAGATTGAGACGCAGTCAAGAGAACCAACGCACAGCTGAGCGCAGCCTCAGGGAAAGAGACGCTCAGCTCCAGCGCTGCCGCAGTCAAATGCAGAAGCTGCAACAACTCGCAGATGACCAGAATCTTGGAGAGAGAGAGGAACTCTCGCGAAAACTAATTGGCACTCAAAGCAGATTGCAAGATAGTGAACACAGAGTGAAGG[T/C]AAAAACATTTAAAAAACTAACTAACTAAGTATAGCAATGTCTTGCTTAATTTGTAAATGAATAATTCCCAGAACAAATCCAGGGAATAAAAGTTACTGTGACCGACGTCCACCAAACGATTTCAGTTTTCCTGGAACATGACATCATTAAACGGTGATACTAAATGGTCTTTAATTATTTTGTGCCATTTAATGTTATAGGTCAGTCATGGTTAATAAAAACAAGCTACAAACATAAATCCTATGAACAATCACTAATCAGTTCACTTCACTGTTATGTGCCAAGTGAAAAAAATAATAATTAATGATTCAGTCTAATATTCAAGAAGAGCCCACGGTTACCTCTTTTGTCATGGTTTCTGTCTGACTTGAGATCGCTGTGCTTCTGTCTCCCACTATCCTGATCCAATTACGCTGTTCCTTCTTCTCGAGATCTCTTTTGATCAGGCCCGTTATCCGTTTTACCTGTGGTTTTAAAAAATTAAAATATACATCTCCTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37755
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112619 Nonsense 385 753 5 7
ENSDART00000132736 Nonsense 385 460 6 8
Genomic Location (Zv9):
Chromosome 23 (position 31626532)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 31461422
GRCz11 23 31387953
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATTTTGTGTTAAAGGCTTTAATATAACCAGCACTAAAGCAGTACAGACA[G/T]AGGACAGAACATCCTCATTGGATTTCCCATCGCCACCTCCAGCTCTTACC
Long Flanking Sequence:
ACATACAGTAACATGTGATTATGCAGTATTAGACTTCCATTCATTTATTCACAAACTCATCAAACCTGACCATTTTTTAATGTCTTGCATCAGGAGAAAGAAAGGGAGCTGGATGCCCGAAACATTTACGCTAACAGGATGCACAAAGCTTCTTCCAGGAAAGAAGCAGAGAATGGCAGTAAACGGAAAGGTAGATTTGTTAAAGTCCCATTGCACAGCTGTACCTTCATCTAAGGGCTTTCTTACATGTAAACAGTAAGTCCATAATTACTGCATGCAAACAGGGAGTGACTCCATAACAAACATCTTCCTATTGTAATTATATTCTCTAGCTTTAATTAAAGTGCTCTTTTGGATTAGTTAAATGGCTTTGAGATTTGATTAAGAGTGTTTGTTAGGGCTCTGAAGAAAACAGTATTGTTTTGTGAATGTGTTTGTGTGTAATGTATGTATTTTGTGTTAAAGGCTTTAATATAACCAGCACTAAAGCAGTACAGACA[G/T]AGGACAGAACATCCTCATTGGATTTCCCATCGCCACCTCCAGCTCTTACCAATAATCTTCCACCTGATGACCAGACTGATGATTACCTTTCTCTGAAGGCATGTACTTGCAAAATGACTTATAAATCACATTCTTTTTCTTACTTTTTTTTTTTTTTTTACCATTTAATTATTTACTGTCATAAATGGTGTATGTAATTGAATGGAAAGTTTAGCCAGAAATGGCAATTAGTTGTTAATTTACTGAAACTTAGGCCGTCCAAGATGTAGGTGACGTTTTTTTCCCCAAAACATAAATGTATTTTTTTTTTTCTTGAAAGTTAATAAACATATAGAGGGCAAACTAAATGAATTTGTTAGGGTGAGTAAATTAACCAAGTTTTCATTTTGGAGTGAACATGCCTTTAATTGTATCTATTGTAGCTTCAAAAGATTAAGTCATTAAATATGCCAGTGCTGTTAAAATCTTGTGAGCTGCCTTGTTGTCTGTCGCCTTCATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11604
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112619 Nonsense 391 753 5 7
ENSDART00000132736 Nonsense 391 460 6 8
Genomic Location (Zv9):
Chromosome 23 (position 31626513)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 31461403
GRCz11 23 31387934
KASP Assay ID:
2261-7993.1 (used for ordering genotyping assays)
KASP Sequence:
TAATATAACCAGCACTAAAGCAGTACAGACAGAGGACAGAACATCCTCAT[T/A]GGATTTCCCATCGCCACCTCCAGCTCTTACCAATAATCTTCCACCTGATG
Long Flanking Sequence:
TATGCAGTATTAGACTTCCATTCATTTATTCACAAACTCATCAAACCTGACCATTTTTTAATGTCTTGCATCAGGAGAAAGAAAGGGAGCTGGATGCCCGAAACATTTACGCTAACAGGATGCACAAAGCTTCTTCCAGGAAAGAAGCAGAGAATGGCAGTAAACGGAAAGGTAGATTTGTTAAAGTCCCATTGCACAGCTGTACCTTCATCTAAGGGCTTTCTTACATGTAAACAGTAAGTCCATAATTACTGCATGCAAACAGGGAGTGACTCCATAACAAACATCTTCCTATTGTAATTATATTCTCTAGCTTTAATTAAAGTGCTCTTTTGGATTAGTTAAATGGCTTTGAGATTTGATTAAGAGTGTTTGTTAGGGCTCTGAAGAAAACAGTATTGTTTTGTGAATGTGTTTGTGTGTAATGTATGTATTTTGTGTTAAAGGCTTTAATATAACCAGCACTAAAGCAGTACAGACAGAGGACAGAACATCCTCAT[T/A]GGATTTCCCATCGCCACCTCCAGCTCTTACCAATAATCTTCCACCTGATGACCAGACTGATGATTACCTTTCTCTGAAGGCATGTACTTGCAAAATGACTTATAAATCACATTCTTTTTCTTACTTTTTTTTTTTTTTTTACCATTTAATTATTTACTGTCATAAATGGTGTATGTAATTGAATGGAAAGTTTAGCCAGAAATGGCAATTAGTTGTTAATTTACTGAAACTTAGGCCGTCCAAGATGTAGGTGACGTTTTTTTCCCCAAAACATAAATGTATTTTTTTTTTTCTTGAAAGTTAATAAACATATAGAGGGCAAACTAAATGAATTTGTTAGGGTGAGTAAATTAACCAAGTTTTCATTTTGGAGTGAACATGCCTTTAATTGTATCTATTGTAGCTTCAAAAGATTAAGTCATTAAATATGCCAGTGCTGTTAAAATCTTGTGAGCTGCCTTGTTGTCTGTCGCCTTCATATGTAGCTTTAATTGTCAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1415
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Missense, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112619 Missense 420 753 6 7
ENSDART00000132736 Nonsense 420 460 7 8
Genomic Location (Zv9):
Chromosome 23 (position 31623265)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 31458155
GRCz11 23 31384686
KASP Assay ID:
554-1336.1 (used for ordering genotyping assays)
KASP Sequence:
TTGTTTGTCATTTATTTTCTTTTTTATAAAACATGTTAGCAGGATCAGCA[A/T]AGCAGAGAGCACAGGACGAGAGAATCGAAGGAATGGAAGATTCAAGAGTT
Long Flanking Sequence:
GTGATGTTTAAATAAAGAATCAAAGTCTAGTTTATCCAAAAAGGAAAATAAGTCATCATTTACTCAACCTTCATGTAATTTATGGTTCATAACGTTCTTATTTTTCTGTTTGTGAAACTCTCAAAACAGCAATATATAGCACTGAATGTATTTTACACTTCAATTCAATGGAGATCTCATAAAAAGATGACACATAACTACAAAGTAGATAATTTTCTCTGCAACTGCTGATGATCTGTATTCAGCTATTTTGTGTTAGGCTTGACATCAGTGATTCCGAATGTCATTGATTTTTGTATTTTTAACCAATGCCAAATTCATGAAGGTGACAGAATGCTGACCATTTTCATTTTTGTACAGCCTATCACTTTAAACGCATGCATAACCTTTCAGTTAGATGACCGTTTTGTTATATCATTTTGTACTGTGTTTTTACTCCAGGCTGACCCTTTGTTTGTCATTTATTTTCTTTTTTATAAAACATGTTAGCAGGATCAGCA[A/T]AGCAGAGAGCACAGGACGAGAGAATCGAAGGAATGGAAGATTCAAGAGTTTTGGAGAGAAAGGGAGAAAGAAAGACACATGGAATCTGCAAGAGAACAGGAGAAAGAAAAAGAGACACTGCATGAGAGAGAAAGACAAACAGAGCTGCTGAAAGATGTGGAGAGGCAAAGACTAGATCAAGATCTCAGCTCAAATGAGAAGAACTTTAAAGGAAACAGAGGTAGGAATGTAGAAGCCACCATAATTCACTGATAATACAGCTAAAAGCAGAAGCTCAAGTTTACAGTCATGAATAGAATTGATGTTGGTCTATATATTATAGATATTATAATATTTTATGTACATTACAATTCAAAGTTAGGGAGTTGGAAGATTTTTTTAATGATCTTGAAGGACTAATTTTACAGAGAGGGCTCAGGCTAAGTGAGGTGTAGGCTATAGTTCAATTAGGACATTTAAGTAATTTTATAAATGTGCTTTGAGACAAAACAAAGACACTG
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa10874
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Missense, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112619 Nonsense 423 753 6 7
ENSDART00000132736 Missense 422 460 7 8
Genomic Location (Zv9):
Chromosome 23 (position 31623258)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 31458148
GRCz11 23 31384679
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCATTTATTTTCTTTTTTATAAAACATGTTAGCAGGATCAGCAWAGCAGA[G/T]AGCACAGGACGAGAGAATCGAAGGAATGGAAGATTCAAGAGTTTTGGAGA
Long Flanking Sequence:
TTAAATAAAGAATCAAAGTCTAGTTTATCCAAAAAGGAAAATAAGTCATCATTTACTCAACCTTCATGTAATTTATGGTTCATAACGTTCTTATTTTTCTGTTTGTGAAACTCTCAAAACAGCAATATATAGCACTGAATGTATTTTACACTTCAATTCAATGGAGATCTCATAAAAAGATGACACATAACTACAAAGTAGATAATTTTCTCTGCAACTGCTGATGATCTGTATTCAGCTATTTTGTGTTAGGCTTGACATCAGTGATTCCGAATGTCATTGATTTTTGTATTTTTAACCAATGCCAAATTCATGAAGGTGACAGAATGCTGACCATTTTCATTTTTGTACAGCCTATCACTTTAAACGCATGCATAACCTTTCAGTTAGATGACCGTTTTGTTATATCATTTTGTACTGTGTTTTTACTCCAGGCTGACCCTTTGTTTGTCATTTATTTTCTTTTTTATAAAACATGTTAGCAGGATCAGCAAAGCAGA[G/T]AGCACAGGACGAGAGAATCGAAGGAATGGAAGATTCAAGAGTTTTGGAGAGAAAGGGAGAAAGAAAGACACATGGAATCTGCAAGAGAACAGGAGAAAGAAAAAGAGACACTGCATGAGAGAGAAAGACAAACAGAGCTGCTGAAAGATGTGGAGAGGCAAAGACTAGATCAAGATCTCAGCTCAAATGAGAAGAACTTTAAAGGAAACAGAGGTAGGAATGTAGAAGCCACCATAATTCACTGATAATACAGCTAAAAGCAGAAGCTCAAGTTTACAGTCATGAATAGAATTGATGTTGGTCTATATATTATAGATATTATAATATTTTATGTACATTACAATTCAAAGTTAGGGAGTTGGAAGATTTTTTTAATGATCTTGAAGGACTAATTTTACAGAGAGGGCTCAGGCTAAGTGAGGTGTAGGCTATAGTTCAATTAGGACATTTAAGTAATTTTATAAATGTGCTTTGAGACAAAACAAAGACACTGATATGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6746
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112619 Nonsense 493 753 6 7
ENSDART00000132736 None None 460 7 8
Genomic Location (Zv9):
Chromosome 23 (position 31623048)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 31457938
GRCz11 23 31384469
KASP Assay ID:
554-4700.1 (used for ordering genotyping assays)
KASP Sequence:
AAAGACTAGATCAAGATCTCAGCTCAAATGAGAAGAACTTTAAAGGAAAC[A/T]GAGGTAGGAATGTAGAAGCCACCATAATTCACTGATAATACAGCTAAAAG
Long Flanking Sequence:
TCTGCAACTGCTGATGATCTGTATTCAGCTATTTTGTGTTAGGCTTGACATCAGTGATTCCGAATGTCATTGATTTTTGTATTTTTAACCAATGCCAAATTCATGAAGGTGACAGAATGCTGACCATTTTCATTTTTGTACAGCCTATCACTTTAAACGCATGCATAACCTTTCAGTTAGATGACCGTTTTGTTATATCATTTTGTACTGTGTTTTTACTCCAGGCTGACCCTTTGTTTGTCATTTATTTTCTTTTTTATAAAACATGTTAGCAGGATCAGCAAAGCAGAGAGCACAGGACGAGAGAATCGAAGGAATGGAAGATTCAAGAGTTTTGGAGAGAAAGGGAGAAAGAAAGACACATGGAATCTGCAAGAGAACAGGAGAAAGAAAAAGAGACACTGCATGAGAGAGAAAGACAAACAGAGCTGCTGAAAGATGTGGAGAGGCAAAGACTAGATCAAGATCTCAGCTCAAATGAGAAGAACTTTAAAGGAAAC[A/T]GAGGTAGGAATGTAGAAGCCACCATAATTCACTGATAATACAGCTAAAAGCAGAAGCTCAAGTTTACAGTCATGAATAGAATTGATGTTGGTCTATATATTATAGATATTATAATATTTTATGTACATTACAATTCAAAGTTAGGGAGTTGGAAGATTTTTTTAATGATCTTGAAGGACTAATTTTACAGAGAGGGCTCAGGCTAAGTGAGGTGTAGGCTATAGTTCAATTAGGACATTTAAGTAATTTTATAAATGTGCTTTGAGACAAAACAAAGACACTGATATGTTTTAAAATCAGTTGGTGCAAGTTTCTTTAAATTTATTTAAATTAAAACAGCTCAGACTGGTATTTTAGAATGGAACTAGGCTTAACCCTTGTCTGTAAAACCAGGGGTTCATTCTTGTTATATGTTATTTCAAGTAAAAGTGATACTGAAGGTATGTACAAACTGCCGATATTTTCTTACAACAGTAACCTATTGGTTATATATAATGTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37754
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112619 Nonsense 516 753 7 7
ENSDART00000132736 None None 460 8 8
Genomic Location (Zv9):
Chromosome 23 (position 31620009)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 31454899
GRCz11 23 31381430
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGAAGACAGGAGGATTGGCATGTCTGTGTCTCAAAAGGAAGAAGAGATC[C/T]AAAAGCAGCGTGAACTGGAAGAGGAGCAACAAAAAGTGAGAAATCGGGAG
Long Flanking Sequence:
TCAGCCAATCATTGCATAGCTGATCTTGATTTCGAGGATCAATAGATCTGTCCTTCACAACAATCACAAGCACATGCTGCCATTTCAGATCAGTTCATCCAGACATTTTAATCTGATTTGCAAACTTGTTTGAAGAACCAAATTAGCCAGGGATTAGTTATCAAGATTAAAGGTCTAGAGGCTGCCAAATCATTTTAGATAAACATACAAAGAACGTACCCCAGACAGAGAAGTCTTATCATTATGCAAATATTATTATTACAAATTAAAAAAGGTCTCTAATGTAATAAGTTTTAATATACAATTTAGTTCTGTCGAAATCTAAAATGCATTTCCTGTAATTATGAATGTTGAAAGCACTTAATTCTTTTGTGAAAATTATTATCTTTTTTTTTTTAAATCTGCATTGATTAGTCTTTGTTTCTTCTTCAGTAGGCCTAAACAGAGAGGAGGAAGACAGGAGGATTGGCATGTCTGTGTCTCAAAAGGAAGAAGAGATC[C/T]AAAAGCAGCGTGAACTGGAAGAGGAGCAACAAAAAGTGAGAAATCGGGAGATCCAGGACTACAATCAGGAGCGCGTGGAAGAAGAACGTCAGCGTAAAGAGCAGCTATTAGCTAAGATGCGTGAGATTGACATTCAAACTCAAGGTCAGGACTCCGACTTCTTTTCAGATGACACAGGAAGTGTTCGCTCTCCTCCGCGATTGTCTGAGCAACGGAACCACAATGGTTTTTTCAAGTTAACAGAGCCAGATGAAAACATAAACACATTTTCAAGCGGAAGAAGAGGAGGCAGTCTCCGAGCTCAGGCACCCAACGAGGATCTTGATCTTGCTTTCGGCAGCTACGCACCTTCTTTTGGTAAGTCCACCCCACGCGCAGGTTTGGGGACACGAAATGCACAAAATCACTCCCCTCGAGAACTTGATGAAGGGCTGGATCTGGGTGGCCTGGTCAAAGAGAGGAAGTCAAACCTCATGCAGCAGCTTTTTGGGGCCACTGCA
Associated Phenotype:
Not determined