Busch Lab

ZMP

si:ch211-134m17.7

Ensembl ID:
ENSDARG00000076135
ZFIN IDs:
ZDB-GENE-080424-3, ZDB-GENE-080424-3, ZDB-GENE-090313-29
Description:
Novel protein similar to vertebrate multimerin family [Source:UniProtKB/TrEMBL;Acc:B8A4A4]
Human Orthologues:
MMRN1, MMRN2
Human Descriptions:
multimerin 1 [Source:HGNC Symbol;Acc:7178]
multimerin 2 [Source:HGNC Symbol;Acc:19888]
Mouse Orthologues:
Mmrn1, Mmrn2
Mouse Descriptions:
multimerin 1 Gene [Source:MGI Symbol;Acc:MGI:1918195]
multimerin 2 Gene [Source:MGI Symbol;Acc:MGI:2385618]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa45484 Nonsense Mutation detected in F1 DNA Not yet available
sa548 Nonsense F2 line generated Not yet available
sa22282 Nonsense Available for shipment Available now
sa22281 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa45484
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114773 Nonsense 32 1093 1 8
ENSDART00000136808 Nonsense 26 544 1 7

The following transcripts of ENSDARG00000076135 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 22786273)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22515611
GRCz11 13 22646061
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTACAACCACTTGTTGTCCTGGTGCTTTGTGCCAGTTGATGTGCGTTTT[A/T]AGGAGCACACAGATATGGTGGTGCTAAAGTTGTCTGTTCTTCTTCAGGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa548
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114773 Nonsense 148 1093 2 8
ENSDART00000136808 Nonsense 142 544 2 7

The following transcripts of ENSDARG00000076135 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 22773042)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22502380
GRCz11 13 22632830
KASP Assay ID:
554-0458.1 (used for ordering genotyping assays)
KASP Sequence:
TATACATACCAGGTTGCRTTGTTGATGTTGTCTCTCCTTTCCAGGAATTG[G/A]TGTGCGTTTGTTCACAAGCAGGCTGTGACTGTGGCTGTAGCCTGTGGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22282
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114773 Nonsense 287 1093 5 8
ENSDART00000136808 Nonsense 281 544 5 7

The following transcripts of ENSDARG00000076135 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 22768157)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22497495
GRCz11 13 22627945
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGGAGGTCTAATGTATGAAGCTCAGCAACCTGATGTGGAGAATCAAACT[G/T]GACCGTCCATAGAGGATTATGAGCATATCCCTCCTGCTGGTCAAGAAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22281
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114773 Nonsense 609 1093 7 8
ENSDART00000136808 None None 544 None 7

The following transcripts of ENSDARG00000076135 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 22762208)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22491546
GRCz11 13 22621996
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCTGCAGGATGTGGAGACTGATGTCGACAACATTTATATCGATTTTTAC[A/T]AAAATATAAGTTCAGCAAGTGGAGAATGTGACTGCATTGCTCTTGGAGCA
Associated Phenotype:
Not determined