Busch Lab

ZMP

si:dkey-20i10.4

Ensembl ID:
ENSDARG00000076127
ZFIN ID:
ZDB-GENE-090313-230
Description:
Novel protein similar to vertebrate gamma-aminobutyric acid (GABA) A receptor, beta family [Source:U
Human Orthologue:
GABRB1
Human Description:
gamma-aminobutyric acid (GABA) A receptor, beta 1 [Source:HGNC Symbol;Acc:4081]
Mouse Orthologue:
Gabrb1
Mouse Description:
gamma-aminobutyric acid (GABA) A receptor, subunit beta 1 Gene [Source:MGI Symbol;Acc:MGI:95619]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa14288 Nonsense Available for shipment Available now
sa22246 Essential Splice Site Available for shipment Available now
sa35434 Nonsense Mutation detected in F1 DNA Not yet available
sa10445 Essential Splice Site Available for shipment Available now
sa7370 Missense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa14288
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108535 Nonsense 101 484 4 9
ENSDART00000139841 None None 199 None 2
Genomic Location (Zv9):
Chromosome 13 (position 12198738)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 12197106
GRCz11 13 12329581
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTGWGTGWTTTCAGGACTACACYATTACCATGTATTTCCAGCAGTCCTGG[C/T]GAGACAAGCGTCTGTCCTACACAGGGATTCCTCTTAATCTTACTTTGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22246
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108535 Essential Splice Site 162 484 4 9
ENSDART00000139841 None None 199 None 2
Genomic Location (Zv9):
Chromosome 13 (position 12198923)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 12197291
GRCz11 13 12329766
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACCGCATGATCCGTCTGCATCCTGATGGGACTGTCCTCTACGGCCTCAG[G/A]TCAGTGTATGTGTGTGTGTGTGTGTGTTTGCATGTGTGCATACTGTATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35434
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108535 Nonsense 192 484 6 9
ENSDART00000139841 None None 199 None 2
Genomic Location (Zv9):
Chromosome 13 (position 12225738)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 12224106
GRCz11 13 12356581
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGTATTCCTGAGAGCCTTTCTGTCCCTCTTTTGTCTCTCAGATGGATA[C/A]ACCACAGATGACATTGAGTTCTACTGGCAGGGAGGAAGTTCGGTGACGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10445
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108535 Essential Splice Site 234 484 6 9
ENSDART00000139841 None None 199 None 2
Genomic Location (Zv9):
Chromosome 13 (position 12225866)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 12224234
GRCz11 13 12356709
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCTATTATTGATTATAAAACACTGTCTAAGAAAGTGGTGTTCGCCACAG[G/A]TACAGTGCGCTCCCTGCATGTCCATGAGATGAATAGACTGTTTTTCGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7370
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108535 Missense 246 484 7 9
ENSDART00000139841 None None 199 None 2
Genomic Location (Zv9):
Chromosome 13 (position 12226603)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 12224971
GRCz11 13 12357446
KASP Assay ID:
554-4075.1 (used for ordering genotyping assays)
KASP Sequence:
TCANATTTCTCACTTTYAGGGTCGTATCCTCGTCTGTCTCTCAGTTTTAA[T/A]WTGAAGAGAAACATTGGATATTTCATYCTGCAGACCTACATGCCTTCAACC
Associated Phenotype:
Not determined