Busch Lab

ZMP

si:ch211-160b11.4

Ensembl ID:
ENSDARG00000076122
ZFIN ID:
ZDB-GENE-081104-142
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B0V232]
Human Orthologues:
REG1A, REG1B, REG3A, REG3G, REG4
Human Descriptions:
regenerating islet-derived 1 alpha [Source:HGNC Symbol;Acc:9951]
regenerating islet-derived 1 beta [Source:HGNC Symbol;Acc:9952]
regenerating islet-derived 3 alpha [Source:HGNC Symbol;Acc:8601]
regenerating islet-derived 3 gamma [Source:HGNC Symbol;Acc:29595]
regenerating islet-derived family, member 4 [Source:HGNC Symbol;Acc:22977]
Mouse Orthologues:
Reg1, Reg2, Reg3a, Reg3b, Reg3d, Reg3g, Reg4
Mouse Descriptions:
regenerating islet-derived 1 Gene [Source:MGI Symbol;Acc:MGI:97895]
regenerating islet-derived 2 Gene [Source:MGI Symbol;Acc:MGI:97896]
regenerating islet-derived 3 alpha Gene [Source:MGI Symbol;Acc:MGI:109408]
regenerating islet-derived 3 beta Gene [Source:MGI Symbol;Acc:MGI:97478]
regenerating islet-derived 3 delta Gene [Source:MGI Symbol;Acc:MGI:1353426]
regenerating islet-derived 3 gamma Gene [Source:MGI Symbol;Acc:MGI:109406]
regenerating islet-derived family, member 4 Gene [Source:MGI Symbol;Acc:MGI:1914959]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa7633 Missense Mutation detected in F1 DNA Not yet available
sa12699 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3737
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110325 None None 289 None 5
ENSDART00000137862 Essential Splice Site None 323 1 7
Genomic Location (Zv9):
Chromosome 9 (position 35958093)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 35177604
GRCz11 9 34986789
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCTCATAGCACAGAAAGGAACACACTACAGACCTACAAGATCAGCACTG[G/A]TGAGAATAACTTACTGTATATATTTATGTAGATATTTTCTTTCTTTCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7633
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110325 Missense 135 289 1 5
ENSDART00000137862 Missense 169 323 3 7
Genomic Location (Zv9):
Chromosome 9 (position 35956036)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 35175547
GRCz11 9 34984732
KASP Assay ID:
554-4360.1 (used for ordering genotyping assays)
KASP Sequence:
GYGGAGGAACCTGNNNNNNNNNNNNTGGAATTCCAGTCTGAGGAGCCCACACTTCAAGCWGA[C/A]TATATAGTGGTTGAAGAAYCAGAAGTAGACATGAWTCCTGGCAGRAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12699
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110325 Nonsense 211 289 3 5
ENSDART00000137862 Nonsense 245 323 5 7
Genomic Location (Zv9):
Chromosome 9 (position 35953644)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 35173155
GRCz11 9 34982340
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AATGRTCACYTGGCTTCYGTGACAAGCAGCTTTATTCGTGCTGAAATCTA[T/A]AATCTAATGGACCRGTACAGCAGCCGCTCTGACACATGGCTTGGAGGAAG
Associated Phenotype:
Not determined