Busch Lab

ZMP

B3DJK9_DANRE

Ensembl ID:
ENSDARG00000076120
Description:
Rassf8 protein [Source:UniProtKB/TrEMBL;Acc:B3DJK9]
Human Orthologue:
FOXP4
Human Description:
forkhead box P4 [Source:HGNC Symbol;Acc:20842]
Mouse Orthologue:
Foxp4
Mouse Description:
forkhead box P4 Gene [Source:MGI Symbol;Acc:MGI:1921373]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa31825 Nonsense Available for shipment Available now
sa35072 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa31825
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114288 Nonsense 187 696 6 18
ENSDART00000122918 Nonsense 187 696 5 18
Genomic Location (Zv9):
Chromosome 11 (position 22862877)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 21869108
GRCz11 11 22029676
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTTGATCCAGATGCAACAGCTACAGCAGCAACACATTCTGAATCTACAA[A/T]GACAAGGCCTGGTGAACCTACAGCCGGGCCAAGGAGCAGTACCCATTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35072
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114288 Essential Splice Site 207 696 6 18
ENSDART00000122918 Essential Splice Site 207 696 5 18
Genomic Location (Zv9):
Chromosome 11 (position 22862941)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 21869172
GRCz11 11 22029740
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAACCTACAGCCGGGCCAAGGAGCAGTACCCATTCAGAGCCTGCAGCAAG[G/A]TACACAATAAAATCAAACACAGCATTTGTTGAACCAGACTAACAAGTCAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27772
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114288 Essential Splice Site 648 696 17 18
ENSDART00000122918 Essential Splice Site 648 696 16 18
Genomic Location (Zv9):
Chromosome 11 (position 22920549)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 21926780
GRCz11 11 22087348
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAACAGTAACGGCAGCTGCAGCCCCGGCCTTTCTCCACAGCAGTACGGG[T/G]GAGGCTACTCAACTGATCCCTTGTACAGTTATGATAAAGCACATGTGACA
Associated Phenotype:
Not determined