Busch Lab

ZMP

emid1

Ensembl ID:
ENSDARG00000076119
ZFIN ID:
ZDB-GENE-070705-40
Description:
Novel protein containing an EMI domain [Source:UniProtKB/TrEMBL;Acc:A5PMT1]
Human Orthologue:
EMID1
Human Description:
EMI domain containing 1 [Source:HGNC Symbol;Acc:18036]
Mouse Orthologue:
Emid1
Mouse Description:
EMI domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2155091]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa17183 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17183
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114424 Essential Splice Site 67 211 None 9
ENSDART00000146872 Essential Splice Site 306 447 None 16
Genomic Location (Zv9):
Chromosome 5 (position 26570793)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 24398058
GRCz11 5 24901858
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
NNNNNNNNNNNNGCCCCCTCGCAYGGACCACCAGGYCCAGCTGGAYCAACCGG[T/G]CAGTAAATCAGAATTAAGAGAACATTTTGATTTCATTATTGGTCATGCAT
Long Flanking Sequence:
GCAATGAAAGCATGCATTTGTACAGTATGTCTTTATTGCTTTATTTTATAATCATATTAAATGTCTGCTCTGATTGTCATGCTTGCATGTGGGTCAGTAAAGGAGAAATTACAGCCCTCACACAAGAAAAAGACAAAGAAAACCATTAGGCTGCAAAACGAAAGAAAACTGCTGGCTTGTCATTTTTTGTTATTTAATTCCCTTCTTGTGGCTGAAAATAAAAGCCAACACATCAAAATGCCACAACCAATATTAGAATTTATGGTGTGCCAATATTTTACAGCCTGCCACAAATCACATCACTTATTCTTGTTAAATAGCGCCGTCTACAGGCAAGTAGCTATAATGATGCTTTTCATCAAGCCATGGACTACCTTATTAAGATTTGTGTTGTTTTTAATTGTCACAGGTCTGAAAAAAGAAAGTCTGCTTCATAACAACTTCCCAGACCTTCGAGTGGCCCCCTCGCACGGACCACCAGGCCCAGCTGGACCAACCGG[T/G]CAGTAAATCAGAATTAAGAGAACATTTTGATTTCATTATTGGTCATGCATACCATTTGTGATCTCTACGATTAAACTATAGAACATTTTGAGGCAACAGAAATAATGGTCCTGATGTATTCCCTGTTTTACGTTGTTTAATTTCTATAGCTTCCAAGAATCTAAAAAGAGCCATATATTAATAAATAATGTTATGATAGCTGATTTAACATTAAGTCATGATTGAATTGCCTCTCGTTACAGTTATAGAATAGTTTGATACCAAGCAGGAAATGTTTGTGGGCTGGTGACATGTCCACAATGAAATGGTCTATGTACAATCTTTTGAAAGACTAATTTAAAAATAAGAGAGGACTGAAATATTTTCATTTTGTACAAATTTTTGGCATATTTACAGAAGTGGCAGCAGCATTCTGTATATAAAAACATCCATGAGATGAAGGTCAAACATACTGAATCGTCTTTAATTTCACGGTGCAGGACAATTTTTTATGCCCCACA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2245
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114424 Nonsense 110 211 5 9
ENSDART00000146872 Nonsense 349 447 13 16
Genomic Location (Zv9):
Chromosome 5 (position 26565651)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 24392916
GRCz11 5 24896716
KASP Assay ID:
554-3233.1 (used for ordering genotyping assays)
KASP Sequence:
AGAGAGTGCATTTCTCACCTTTAATGTAATTAACAGGGACCTCTTGGATA[T/A]CCAGGAGAGAGAGGGTTCAAAGGAGAGCCGGTAAGATGCCTGCTTTCTTA
Long Flanking Sequence:
GCCCTTTTAGCTGCAACCCTGTACTGGAAAACATCCATACACTCACATTCACACACATACACTATGACCAATTTAGTTTATTCAATTCACCTATACCGCATGTCTTTGGACTGTTGGAAACCGGAGCACTTGGAGAAAACCCACACGAACATGGGGAGAACATGCAGACTCCAAACAAAAAAGCCAAGTGCCCCAGCCGGGACTTGAACCAGCGACCTTCTTGCTGTGAGGCGACAGTGATAACCACTGAGCCACCATGTCGCCCCCATTATAATATAGTTAATTCATTTTATTTCTCTGTAAGCATGCATGCACACTAACCATATCATCTTTATCTTGTACTCAGGGAAAGCCAGGAGCTCCTGGTTTGCAAGGCCCTGTTGGACCAAAGGGTGATCGAGGTGAAAGAGTGAGTACACAAGATTAAAACTTCCAAAAGTTTAAAGAGAGAGAGAGTGCATTTCTCACCTTTAATGTAATTAACAGGGACCTCTTGGATA[T/A]CCAGGAGAGAGAGGGTTCAAAGGAGAGCCGGTAAGATGCCTGCTTTCTTAGCAAATAACAGGACAGCACTGTATGAAAGCTGTGTATCGAGTATCAAAAAGATGTTCAGTGCTTGTTTGAGAACCACCCTGAAATTTAGATTAGTATTCATGTTTTTTCTCTTCCCAGGGAGAGCCAGGACCTAAAGGAGAGCCAGGGGAGAAAGGTCTTCCGGTAAGACAAGTCTATCAGGAGCCCTGTTAGCCACACACTTACTCTCTGATCATGCTAAACCTTTACAGGAAGCAGCGTGGGAGAGAAAATGAGTTCCTCACTGTTTAACCGCATTGATTTTTAATAATCTCTTTCCTTATGCCTGCTTATCGTTGTTCTAGAGCGAATTGAACGTAAGAGATTTTGACATTTGCCATGATGTTCTTGTTATTCCTGGTTTTACGATTTCCATTGCTCAAACATGCCATTCATCTGTGTGTTAACATAAGCGATCATGTTAAATCCAT
Associated Phenotype:
Not determined