Busch Lab

ZMP

si:ch211-268f14.2

Ensembl ID:
ENSDARG00000076113
ZFIN ID:
ZDB-GENE-070705-261
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A5WW76]
Human Orthologue:
TRAPPC9
Human Description:
trafficking protein particle complex 9 [Source:HGNC Symbol;Acc:30832]
Mouse Orthologue:
Trappc9
Mouse Description:
trafficking protein particle complex 9 Gene [Source:MGI Symbol;Acc:MGI:1923760]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa7465 Missense Mutation detected in F1 DNA Not yet available
sa4781 Nonsense F2 line generated Not yet available
sa43208 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa7465
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110213 Missense 12 164 1 3
ENSDART00000141079 None None 133 None 2
Genomic Location (Zv9):
Chromosome 19 (position 5166858)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 4418204
GRCz11 19 4348452
KASP Assay ID:
554-4084.1 (used for ordering genotyping assays)
KASP Sequence:
TTCCTTGACCAGCGGTGCACTCGTCTCTTCAGCGCGGCGGGGAGGCCAGT[G/A]TGGAGGGCGTCCTYAACCAGCTGATCCTRGAGCATCTGCAGCTGGCTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4781
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110213 Nonsense 81 164 2 3
ENSDART00000141079 Nonsense 50 133 1 2
Genomic Location (Zv9):
Chromosome 19 (position 5275681)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 4526937
GRCz11 19 4443433
KASP Assay ID:
554-3531.1 (used for ordering genotyping assays)
KASP Sequence:
AAGAGCGCCGTCGGGCCCTTYKCTCTGACCGTCGTCCCCTTCCAGGACTA[T/A]CAGAACGGGGTGCAAAACTAYGAGCTGCAGGACGCCGTCACCTTCATCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43208
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110213 Essential Splice Site 106 164 2 3
ENSDART00000141079 Essential Splice Site 75 133 1 2
Genomic Location (Zv9):
Chromosome 19 (position 5275757)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 4527013
GRCz11 19 4443509
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCAGGACGCCGTCACCTTCATCGGCTCCAACACCTTCTACATCAACTCG[G/A]TAAGCGAAGCGGAGGGACACTGACCCACATCATCATCGAGATTTCCTGAA
Associated Phenotype:
Not determined