Busch Lab

ZMP

B6E445_DANRE

Ensembl ID:
ENSDARG00000076104
Description:
Semaphorin 4b [Source:UniProtKB/TrEMBL;Acc:B6E445]
Human Orthologue:
SEMA4B
Human Description:
sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (se
Mouse Orthologue:
Sema4b
Mouse Description:
sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (se

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa11494 Nonsense Available for shipment Available now
sa13494 Nonsense Available for shipment Available now
sa44667 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26968
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109243 Nonsense 68 849 2 14
Genomic Location (Zv9):
Chromosome 7 (position 31588675)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 29981017
GRCz11 7 30252167
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAGATGCAGAAGGGCGATCAGTGAGCGGGTTCTCTGTGAATGGTGTGTA[C/A]AACTATTCAGCTCTTCTGCTGAGCCCAGATGAAAACAAGATCTATGTGGG
Long Flanking Sequence:
CAGTAGTGAAAAAAATGAGTTCATTTCTAAATTTGTTGTTTTGCTTGTTTTTTATACTTGCGTAAACTTTAAAAATTTAATGTAGTGTTTAATTTTACATTTTCAAAAGAAAAAAAAGACATTCTTTAATGTAATTATTGTAATCATAAGATGATCATCCACTTTTATTTTATGGCCTATTAAGTATTTGTTCTGGCACACTTTTGGCCACCAATAGAATTTTAAAAATATTCATTTGAGAATGAACGATACCCAACCCTAGCCGACACTATTAAATTTCAAGTGTTTCATTTAAGAACTTTGGCTCTAATGGCTTTCCATAAGTGCATATAGAGTACAAGTGTTCTGTGCTGATTCTGAAATTCACCTCATGTGCACTGTCCATCAACAATCTTCTCCTTATGAATTGCTTTTAGCCTGTATAGGTAATATTGTCATCTCTGTGTGTGTTCAGATGCAGAAGGGCGATCAGTGAGCGGGTTCTCTGTGAATGGTGTGTA[C/A]AACTATTCAGCTCTTCTGCTGAGCCCAGATGAAAACAAGATCTATGTGGGAGCCAGAGAGAACATATTCTCCCTCAGCCTGGACAACATCAGCGTGACGCACCTACAGAAAACAGTAAGTTCATGGGAGAATGTTTGTAGTAGTGTGTAGGAGTACATTTTGACGTTACTTAGACGTTTTCATCTTTTGCAGCTCACGTGGAGCACTCCTGAAACAAAGAGGGGAGAGTGTATCTTTAAGGGAAAAGACCCCCAGGTATGTGTGTTGTGGCAATTCTTAATATATGTATATGTGAAGGAATGTATTAAAGCAACAAACTGAAAAGTAGTTTGATTCTTATGTGTTTCAGACTGATTGTTTCAACTACATCAAGATCTTACTGCGTCTGAACAGCACACACCTGTTTGTGTGTGGAACGTATGCATTCAGCCCCATCTGCACTTATATTGTGAGTTTTTGTATTCATATGTCTAGTATGAAGTCTGAAGTGTGTCTAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11494
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109243 Nonsense 444 849 10 14
Genomic Location (Zv9):
Chromosome 7 (position 31595922)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 29988264
GRCz11 7 30259414
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTYCTGTCAGAAGTCAGCCTGTGCTYTTCACACACACTGTGCACTACACA[C/T]AAATCGCTGTGCACCACGTGAAGGGTCTCCACAGAGCTTATGACGTRATG
Long Flanking Sequence:
TTTAACTTACCAAGTGTACCAATATTACTGGAAAGGTCTGCATACTAAACTTCTGATGTGTTTATTTTACTTTTCTACTCTGCATACTGTTTGTTTCTAATCTGCTGCTGTGTTTTGCAGGAGTAAAGGTCTTGCTGGCAGTTCCGCAGTGTGTGTGTTCAGCATGGATCAGGTGGATCGAGCCTTTACTGGCCGTTACAAAGAGGTGAATCGAGAGACACAACAATGGTACACATACACTCAATCTGTACCTGAACCACGACCAGGAATGGTAAGACAACACACTCCCACATTTACACTCTACCTGTTCTGTACAAGTGGAGAGTCTCTTAGTGTTTTTTTTTCTTTTGTAGTGTATTACTAATGCCTCAAGGCAGCTGGGAATAGACTCCTCTTTGGATATGCCAGATAAGGTACTAAACTTTGTGAAGGACCACTTCCTGATGGACCGTCCTGTCAGAAGTCAGCCTGTGCTCTTCACACACACTGTGCACTACACA[C/T]AAATCGCTGTGCACCACGTGAAGGGTCTCCACAGAGCTTATGACGTGATGTTCATTGGCACAGGTATGTGAGGCCTTTATGAACATCAGATTTTCTGTGGTTATATTTCATTCCTAATAAGATGGTGATGTTGGGTTTTTGCAGCTGATGGGCGTCTGCAGAAGGCTGTAAATGTAGCTGGTATGATGCACATCATTGAGGAGATCCAGCTGTTCTCAGAACAACAACCAGTACAGCAAATAGAGCTGGATTCAGCTAAGGTGTGTTTGTGTTCTATATTATGTGGTTTACAAGGACACTAAATTGTATAGTGACATAGGTCTGACTGAAGTGTAATACTGATAAGGTGATTTTTCTTTACACTTAAAATCATACTTAACAGGGTGATATTCGCAGTTTAACAGGTTTTGATATTCAAATTTTTAAGGTTTACGGATAGAGGTAGGTTAAGTCCATATAATAAGCTATTTTTACAGTATAAAATACATTACACCTATGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13494
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109243 Nonsense 655 849 14 14
Genomic Location (Zv9):
Chromosome 7 (position 31599952)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 29992294
GRCz11 7 30263444
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGCTTGGTAGTCAGCGGCCGAGCAGGCAGYGACGAGGTCTTCTCATGTTG[G/A]KCARAAGAACGTGGCTTTTGGCAACTCTTGGCCAATTACTGCGTGAAGGC
Long Flanking Sequence:
TGTGGAAAAATTCCTTGCCCTGTTAAACAATTTAGAAAATATTTTAAAAAGAGAGAAAATAATAATAATTTTGACTTCAACTCTCTATATACAATCACAACAACAGTCTGTTTTTACAATCATTAGATGTCATGACAATACTGCTTTTTAGTTGGTGAAAGCCACAGAATTTGATATTTGACTTAAAGTTGGAACCCTACTTAACCATTACATAAAAGTCATCCAAGCATCTATAATCCAAAAAATTAAGTTGTAATATTTACCTCTTCTGCTCTCTTTCTAGTATCACCGCGTTCTTTCACAAATTCCGAAACATCAGATTGTGAGCTCATCATCATCCCAGCAAACACTCTTCAACTTCTACCCTGCAACCTTCGCTCCAACCACGCCCACAGAAAATGGCTATACAAACCAAACGTAAGTCACTTTCTGTTTCCCAGCGCAGATGGTGGCTTGGTAGTCAGCGGCCGAGCAGGCAGCGACGAGGTCTTCTCATGTTG[G/A]TCAGAAGAACGTGGCTTTTGGCAACTCTTGGCCAATTACTGCGTGAAGGCAGAGCCGTTATCTGAAACCACAACCAAAATCGGCCGCAAGGAAGCACCATTTTTAATCCAAAGCATAGCATCGGACATTCTGTCTGAGGAATCCGAAGCACACTCTGCTCAACATCGCATAAAGACGTACGGCACAGAACTGGCGGTGGTGTGTGTTTTATTAGCAGTATGTGTGCTTTCGTTTGGGCTTTCAGTAGTGTATCGACACAGAGGTCGGATGAAGGAGGTACTCAGAGGAGGAGAGCAAGCTGGAGGAGCCCAGAAGAGCACAGTCCACCCTGGGGAGAGCTTGCCTCTCAATGCTGGTGCACCTCCAACCTCGCCATCTGAACACAAAAGCTACCAGACGCTAGAGGAAAACTGTAGTTACATAATCGCTCCGGCAGAAACAAACGCACCGCAGAAATCGGAGGAAACACAGATACTCAAGCCAACACCACAGAATGGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44667
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109243 Nonsense 839 849 14 14
Genomic Location (Zv9):
Chromosome 7 (position 31600502)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 29992844
GRCz11 7 30263994
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATAAAGAGAGTCATGTGGAGGTCAGTGACATTAGCCCTCGTCCTCGGGTA[C/T]GACTAGGCTCTGAGATTAGAGACTCTGTGGTGTAAAATACTGCATATACA
Long Flanking Sequence:
CAGAGCCGTTATCTGAAACCACAACCAAAATCGGCCGCAAGGAAGCACCATTTTTAATCCAAAGCATAGCATCGGACATTCTGTCTGAGGAATCCGAAGCACACTCTGCTCAACATCGCATAAAGACGTACGGCACAGAACTGGCGGTGGTGTGTGTTTTATTAGCAGTATGTGTGCTTTCGTTTGGGCTTTCAGTAGTGTATCGACACAGAGGTCGGATGAAGGAGGTACTCAGAGGAGGAGAGCAAGCTGGAGGAGCCCAGAAGAGCACAGTCCACCCTGGGGAGAGCTTGCCTCTCAATGCTGGTGCACCTCCAACCTCGCCATCTGAACACAAAAGCTACCAGACGCTAGAGGAAAACTGTAGTTACATAATCGCTCCGGCAGAAACAAACGCACCGCAGAAATCGGAGGAAACACAGATACTCAAGCCAACACCACAGAATGGCTATAAAGAGAGTCATGTGGAGGTCAGTGACATTAGCCCTCGTCCTCGGGTA[C/T]GACTAGGCTCTGAGATTAGAGACTCTGTGGTGTAAAATACTGCATATACAGACTGAAACTCTTAATGTTCACTCGGTACAGTCAATGGGCAGCTTTTGTAAAGACTAATCATACTGAGCCTGAGGAAAAAGAGATGGGACATGCTCGGTTTGTGTATTGCCACATTTTAGTTGTTGGAGACAACGCCCTGAAATCTACTCTCACATCTTACAACTTTTAAATGTTATGACACAGTTTATTGTGTTGATATAAAAAAAAAAAGACAGTTAAAATATTTGTGATGTGGACGAGACTAGAGCGGATCGATGTACAGGAAAGGTGGGCAATGGGCTTTGTGTTGTATGACTGCTACTGGTGCTATAATCACTGCCAAGACAAAGAGTGATGAAGCTTCACTCAAGGTGGAAAAAACAGCTTTAAATGACTATTTGTGTTCCTAATGTTTAATGAGGGTACTTTCATCTTAAAAGTTGACTGTGACTGTGAATATCAGGCAGTTC
Associated Phenotype:
Not determined