Busch Lab

ZMP

si:ch211-1f1.2

Ensembl ID:
ENSDARG00000076103
ZFIN ID:
ZDB-GENE-091113-42
Human Orthologue:
GRID2IP
Human Description:
glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein [Source:HGNC Symbol;Acc:18464]
Mouse Orthologue:
Grid2ip
Mouse Description:
glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein 1 Gene [Source:MGI Symbol;Acc:MG

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa11690 Nonsense Available for shipment Available now
sa19978 Nonsense Available for shipment Available now
sa31317 Nonsense Available for shipment Available now
sa33131 Nonsense Mutation detected in F1 DNA Not yet available
sa33130 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11690
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108948 Nonsense 87 1200 1 27
ENSDART00000142478 Nonsense 82 1174 1 25
Genomic Location (Zv9):
Chromosome 3 (position 18529929)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 18558291
GRCz11 3 18708031
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGACCCTCAAGACTGTGCCGCCCAGCATCGGAGTCGTGTCTAGAATAGAA[C/T]AGGTCAGTTATTCRTCTCTGACTTGCTATTTAATGAAACTGACATGCAAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26034
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108948 None None 1200 None 27
ENSDART00000142478 Nonsense 96 1174 2 25
Genomic Location (Zv9):
Chromosome 3 (position 18525871)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 18554233
GRCz11 3 18703973
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCTCTCAGGGACGGACTCTGCGTCTGGGTGTTCTGCGCATAAACCGCTG[G/A]CAGAAACGCACCAGCAGCAGCATGAAGGAGACCTATCACAGCGGAGAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19978
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108948 Nonsense 213 1200 5 27
ENSDART00000142478 Nonsense 202 1174 4 25
Genomic Location (Zv9):
Chromosome 3 (position 18515949)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 18544311
GRCz11 3 18694051
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAAGCACAGGCAGCGCTTTGATGAGATGGTCTCTCAGAGTCTGATCAGT[C/T]GATTGAGGGGCCGAAGCTTCAGCGAGCACAGGAACAATCGGCTACGACGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31317
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108948 Nonsense 453 1200 9 27
ENSDART00000142478 Nonsense 442 1174 8 25
Genomic Location (Zv9):
Chromosome 3 (position 18510492)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 18538854
GRCz11 3 18688594
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATTGTGGATGTCTTCCCTGTGTTGGATACGCCAGCAAAACAGGTGATCT[G/A]GCAATTTGTTTACCAGCTGTTGACCTATGAGGAGCAAGAACACTGCCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33131
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108948 Nonsense 841 1200 19 27
ENSDART00000142478 Nonsense 842 1174 17 25
Genomic Location (Zv9):
Chromosome 3 (position 18506700)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 18535062
GRCz11 3 18684802
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTAGACAATGATTTTATTTTTATATTTCAGATGGAAGAAGACTCTGATTA[T/G]GACAAGCTGAGTGACATGGTGAAATATCTAGACCTGGAGCTTCATTTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33130
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108948 Essential Splice Site 1119 1200 25 27
ENSDART00000142478 Essential Splice Site 1120 1174 23 25
Genomic Location (Zv9):
Chromosome 3 (position 18501477)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 18529839
GRCz11 3 18679579
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCAGAAGATGCCAGCCACTGCTGAGGACCGATTTGCTGTTGTTATGAGT[G/T]TATCCTCTTATCAATATCTAAAATGACTCGATGTAGTGCATTTAAGTTCA
Associated Phenotype:
Not determined