Busch Lab

ZMP

si:ch73-21k16.1

Ensembl ID:
ENSDARG00000076096
ZFIN ID:
ZDB-GENE-081031-51
Description:
Novel lipin protein [Source:UniProtKB/TrEMBL;Acc:B8JM19]
Human Orthologue:
LPIN1
Human Description:
lipin 1 [Source:HGNC Symbol;Acc:13345]
Mouse Orthologue:
Lpin1
Mouse Description:
lipin 1 Gene [Source:MGI Symbol;Acc:MGI:1891340]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa43530 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29459
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109608 Essential Splice Site 43 561 1 19
ENSDART00000137970 None None 302 None 7
ENSDART00000138405 None None 235 None 5
ENSDART00000143596 None None 165 None 5
Genomic Location (Zv9):
Chromosome 20 (position 47116057)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 46964335
GRCz11 20 46868055
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGAAGAAGAAGACGAAGAAGATGAAGCCATCACCTCCAGCTGGTCTTGG[G/A]TAACCTGCTATCTTTATTTGGCATTTTTTATTAGGCATTTGAGTGTAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43530
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109608 None None 561 14 19
ENSDART00000137970 Nonsense 66 302 2 7
ENSDART00000138405 None None 235 None 5
ENSDART00000143596 None None 165 None 5
Genomic Location (Zv9):
Chromosome 20 (position 47189957)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 47011729
GRCz11 20 46915449
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAACTAAATGACGGTGCTAATGACGTGGTGTTTAGCGTGACGACTCAGTA[T/A]CAGGGCACGTGCCGCTGCGAGGGAACCATCTACCTGTGGAACTGGGATGA
Associated Phenotype:
Not determined