Busch Lab

ZMP

dda1

Ensembl ID:
ENSDARG00000076074
ZFIN ID:
ZDB-GENE-040426-2137
Description:
DET1- and DDB1-associated protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q7T2A3]
Human Orthologue:
DDA1
Human Description:
DET1 and DDB1 associated 1 [Source:HGNC Symbol;Acc:28360]
Mouse Orthologue:
Dda1
Mouse Description:
DET1 and DDB1 associated 1 Gene [Source:MGI Symbol;Acc:MGI:1913748]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa38822 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa38822
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104369 Essential Splice Site 48 104 3 5
ENSDART00000123601 Essential Splice Site 48 104 3 5
ENSDART00000140960 Essential Splice Site 48 104 4 6
Genomic Location (Zv9):
Chromosome 11 (position 5984544)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 5952727
GRCz11 11 5949982
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAAGACCGTCAGTGTATCTGCCTACACGAGAGTATCCCTCTGAACAGAG[T/C]AAGCGGGTTTAAATAAAATGTAGACTCGGATAATAAAACTCAAAGTCTTT
Associated Phenotype:
Not determined