Busch Lab

ZMP

si:dkey-86e23.2

Ensembl ID:
ENSDARG00000076055
ZFIN ID:
ZDB-GENE-091204-132
Human Orthologue:
RPGRIP1
Human Description:
retinitis pigmentosa GTPase regulator interacting protein 1 [Source:HGNC Symbol;Acc:13436]
Mouse Orthologue:
Rpgrip1
Mouse Description:
retinitis pigmentosa GTPase regulator interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:1932134]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa24443 Nonsense Available for shipment Available now
sa44087 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa24443
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110516 Nonsense 49 981 1 16
ENSDART00000138541 None None 373 None 13
Genomic Location (Zv9):
Chromosome 24 (position 7879725)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 7737017
GRCz11 24 7766336
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCTTAAAGAAAGACTGGAGGAAGCAAGGAGTGAAAGGAAAACACTGGAG[C/T]AGGAGAAAGAACAGATGAGGCATGAGATTGATCAAGTTAAAAAGGAGAAG
Long Flanking Sequence:
CTGCAATAACAAGGCAAATAATATAATGAATAATGCAGAGTTTATCAAATATAAGATAAGTTCAAATTCTGCTATAAAGCAGCACTAAACCAGTTCTTTGTTAATAAAGTTTCATATAAATCCTCTGCAAATGTAGCAGATTTGGAAATAGCAGCAGCTATTCTATAAGCTATTCTACATTCTTAACAATTCTATTATCTATAAACAGCTAAACAGCAGGATAGCAGTCTTCTTGAGCCAGATTTGGATGAATCAAGTAACTAATAAACAATGTGTGAACCTGAAAATGGAAAAAATCTAGAGTAAAAGCTATATGCTTTGTAATAATTTATATCAATGGTTTCCACCACAGCACTATGTCCATCCAGAACCATCAAGGAGATAAACATGAAGAAAAAGAGGAAAGAAAGGAAGAGTTAAGAGAGGAAGGATGGAGAGAGGAACTTCAGAGGCTTAAAGAAAGACTGGAGGAAGCAAGGAGTGAAAGGAAAACACTGGAG[C/T]AGGAGAAAGAACAGATGAGGCATGAGATTGATCAAGTTAAAAAGGAGAAGGAGCGAGATAAAGGTACTGTAGTCCAACCTGTAGTGATGTCTTGCAATGCCAGAACATTAAATAGCAACATCAGTTCTGGACCACAAATCTGTTAAAAAAGATCCTGTTTGGATTTCACATACAGTGAGTGACAGTTCAAAATGACTACTACCTCCCTGTGTGACACCGCCATGGGACAAAGTTATTAGTAAACTGTTTAGGTGTAATAGCAGTTTGTGTCAATTCCACCAGGGGGCATAATCTAACCACAAACTTGTCAGCTCAATGCCTTCCTCAGTGCGTAAAAAGTTCTTGAGTTTGTTATTATTTTTTTCAACCAATGAACTATACCTACACTCACCGGCCACTTTATTAGGTACACTTGACCAGTACCGGGTTGGACCCACTTTTGCCTTCAGATCCACCTTAATCCTCCGTGGCATAGATTCAACAAGGTACTGGAAATATTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5074
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110516 Essential Splice Site 773 981 12 16
ENSDART00000138541 None None 373 None 13
Genomic Location (Zv9):
Chromosome 24 (position 7866606)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 7723898
GRCz11 24 7753217
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGGAAGTGATGTCGTCATAATTCCTCACCCTCCAAAGCCACAAAAAAAGG[T/A]GAAGGTCACACAAGTCRATTRCATTAAACAMATCTGTTAATGTTACCCAA
Long Flanking Sequence:
CAGCCATCGAGGTCAGTTAGAAGGAAGCACCGTCCTGCAACACTGTCCAACCAGAAACCCACAACTCCACCTTACCGGAGTTCTGCCATGTCTACTCAATCACCTGATGCTAATGCTGTTACTGACTTCAGAGCATCGGTGTCAGAGCCGAGCACTCCACGGAGTCAAAGAAGCTGCAGAAGCGACTCTGAACAGGTAACATAATAGAACAGGAAGATGTAATGTCAGCTAACCCAGTTCAAAAGTGTCATTGTTTTCTTCTTAAATCAATCTAAAAACAGGAAGTTGAAGAACAGGATGATGAAACAGAAGACAAAAGTGAGTTATATATGTCTCCTGTTTTTTACACAAGTTAAACAAATTGAGTTCAAGCTCCTTTTTACCTCTTATATTCAAAATAGCTCAAAGTGACGTAGACGTCCTTCACTCTGAAGAATCGAGAGAATCAAATGGAAGTGATGTCGTCATAATTCCTCACCCTCCAAAGCCACAAAAAAAGG[T/A]GAAGGTCACACAAGTCGATTACATTAAACACATCTGTTAATGTTACCCAAATTTTAGTTTTAGCACAATATAAGTTATTTTAAACTGATAAGATTAAAAAAATCTTAGGTTAAAAAAAAAGGTTAAAAATCCTTATAACAGTGTAAGTAATTTGGACCAAAAGCATTACCAAGACAGCCAGTCAACTACAATTTAATCAAGTACAGCTCAACAAAAATCAAGATAAGTAATTTTTGACCACAGAATGACTGAATGACCTAACAATTTAAGAATTGTCCCTGAAACCAGATTCAGAATTAACTCTCTGGGGTCTGAGGTGTTTTTGAGGCCCCTAAGACATTTTGACATGCCCTGACATGTGTGCTTATTTAAGCTACGTATTACATAGTATTGGTCAGCATGCATTTTTTATTCAGCACAAACTGTGCTACAATAATATGTGAGAGATATTGATGTAAATGTTTGTGGTTTTTACAAAAAAAAAGATGTGGTTTGTACGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44087
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110516 Nonsense 891 981 15 16
ENSDART00000138541 None None 373 None 13
Genomic Location (Zv9):
Chromosome 24 (position 7862702)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 7719994
GRCz11 24 7749313
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATGAAGGAGCAAGAAGAATGTGAAGATGTCGGCTATGCCTACTTGGATT[T/G]ACGAGAACTTCTGCTGACTGGAAATGATGTTATTGAAAAACAAATCAATG
Long Flanking Sequence:
GGTCTCGGGACTGTTGTGGTCTATGGAGGATGAGGGAGCTCTCTGAATTCATCTAAAATTTATTCTTTTGTGTTCTGAAGATAAATAAAGGTCTTTGAGAATTGGAATATTATTAGGATAAGCAATTAAAAAACAGAACAAACTGAATTTACTTTTTTTGGTGAACCAACCCTACAATTTGGTATGAATATTGTTGAAGAGACACATAATTAACAACTGATGTCCTCTTATCAGTTATCCATGTGGATTCAGTGGGAGCAGCTCCACTGAGACACTACCTCTACACCATGCTGGAAGGCACTGACCCCAACCAGGGCAGGTAAACACAGAGATATTGATGTAATGAAAAGAATTCCATGTTAAAATTAAAATAAATACTTGTATACAAAAAGATATTCAGATTTCTAAGCTTCCTTTATGCAGGCTAAAGTTCACAGTGGTCAGTGAGCCCATGAAGGAGCAAGAAGAATGTGAAGATGTCGGCTATGCCTACTTGGATT[T/G]ACGAGAACTTCTGCTGACTGGAAATGATGTTATTGAAAAACAAATCAATGGTAGGAGAATAAAGTCATTTTAGAAGGAGATGAAAATGTACTTGGAATATACACGCATCATTTAGTGTTTGTTTTTCTCCTTGTCAGTTGTCAGTCCGAATGAAGAGCAGGAAGTGGTGGGAAAGCTGAAAGTCTCTGTAGAAGCTGCTCAGGCTCTGACTGGAATCTATCAGGAATATCATCAGACTGTAAAGAGGAACAGAAGAGATCCTCCAAGCAGCACAGAGGATGAGGAAGAAGAAGGGACAAAGAAAAAGGAGGAGTTGCATGTGCTCGATTTTGAAGTTGACGAAGACAGTGATTTTTATTGAAACTCTCCTCTCAAACCAGGCTAGTCTCAAAAAGAACATCAATTGATTTTTTTTATAGAAAAAAAAATGCTTTTGTGACATTGTAACCATATTCAATACTCATCAAATTGTTTTATGTCGTCGTGCTGAAATGCAAAAT
Associated Phenotype:
Not determined