Busch Lab

ZMP

si:ch211-149p5.1

Ensembl ID:
ENSDARG00000076044
ZFIN ID:
ZDB-GENE-070705-41
Description:
Novel protein similar to vertebrate thyrotropin-releasing hormone degrading ectoenzyme (TRHDE) [Sour
Human Orthologue:
TRHDE
Human Description:
thyrotropin-releasing hormone degrading enzyme [Source:HGNC Symbol;Acc:30748]
Mouse Orthologue:
Trhde
Mouse Description:
TRH-degrading enzyme Gene [Source:MGI Symbol;Acc:MGI:2384311]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa45176 Nonsense Mutation detected in F1 DNA Not yet available
sa40298 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa45176
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112301 Nonsense 332 994 3 19
ENSDART00000133056 Nonsense 332 947 3 18
Genomic Location (Zv9):
Chromosome 4 (position 22178548)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 23521883
GRCz11 4 23242858
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGTTGTGTTGTTGTTGTAGATTCGGCTGTACGCCAGACCTGATGCCATC[C/T]AGAGCGGATCGGGTGACTACGCTCTGCGCATCACCAAGAGACTCCTGCAG
Long Flanking Sequence:
ATATTATTTGATTTGCTAAAGATCATGAGACACAAATGAATGGAGTTATGGTGGTAAAAATAACATACATAAGTTGCAAAAAAATAAATAAATATAGATATTTAAACCATATATTTATAAATATTTAACCAGTGGTAAAAGCAACTTTTCTTACTTTTCTGGTGAATCTTTTTTTTAAGATTTATGGGTAGCAGTTCTTCATAATTCAATAATAACATTGCAATCATGGTTGCCCTGCTTAAAAAAAAAAAGGTTCTTGGGTGAAAATTACTGATTTTTAATTTTGTGGCACTCTAGTTTTGAATGTTTTGCATAATAGATGGCGGATGCACTTGAAAGATGAATGAAATATTCAGCCAGATGAAGGCGTTTGGTAGATAAATTCACCATGGCTTACTCTACATTTCTCCTCAAGGGAGACGAATAAGAGTCCATTTTGACTTCTGTTTTCTGTTGTGTTGTTGTTGTAGATTCGGCTGTACGCCAGACCTGATGCCATC[C/T]AGAGCGGATCGGGTGACTACGCTCTGCGCATCACCAAGAGACTCCTGCAGTTTTACCAGGATTACTTCAAAGTCAAATATTCCCTCCCCAAATTAGGTAAGCCGGCCGGTGAAATGTCTTCATCTTTATCTGGCTTCAGTGACGCTGCTGAAACTGGTGATAAATGTTCTTCTCATCAGATTTTTCATTGTTCCTTCTGTCGGTTCTGTGTGAATTCATGTTTCGTTTTGGTGTAAAGAAGTGAAGAGTGTCGATATCAACACAGTTCTTGAGTTTATTGATCCTCAAAGTGCTGCAGGCGTGTGCGCCTGTGTTTGGTCTTGGGAATCAGAGCACGCACCTTGCGTGTGTTGTGAAAGTGTGTGTTTGTGGCTGTATTGACTTGTGTGTGTGCTGTATGTAGTTGTAAGTGTGAGTGTGTTTGTTCTGGACGACTCGTTTCGCTCCATTGGGTTCCTGTCAGCTCTCTGTATTCATTTGAATGTAGGCATCAATCTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40298
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112301 Essential Splice Site 364 994 3 19
ENSDART00000133056 Essential Splice Site 364 947 3 18
Genomic Location (Zv9):
Chromosome 4 (position 22178646)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 23521981
GRCz11 4 23242956
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGTTTTACCAGGATTACTTCAAAGTCAAATATTCCCTCCCCAAATTAGG[T/C]AAGCCGGCCGGTGAAATGTCTTCATCTTTATCTGGCTTCAGTGACGCTGC
Long Flanking Sequence:
TATTTAAACCATATATTTATAAATATTTAACCAGTGGTAAAAGCAACTTTTCTTACTTTTCTGGTGAATCTTTTTTTTAAGATTTATGGGTAGCAGTTCTTCATAATTCAATAATAACATTGCAATCATGGTTGCCCTGCTTAAAAAAAAAAAGGTTCTTGGGTGAAAATTACTGATTTTTAATTTTGTGGCACTCTAGTTTTGAATGTTTTGCATAATAGATGGCGGATGCACTTGAAAGATGAATGAAATATTCAGCCAGATGAAGGCGTTTGGTAGATAAATTCACCATGGCTTACTCTACATTTCTCCTCAAGGGAGACGAATAAGAGTCCATTTTGACTTCTGTTTTCTGTTGTGTTGTTGTTGTAGATTCGGCTGTACGCCAGACCTGATGCCATCCAGAGCGGATCGGGTGACTACGCTCTGCGCATCACCAAGAGACTCCTGCAGTTTTACCAGGATTACTTCAAAGTCAAATATTCCCTCCCCAAATTAGG[T/C]AAGCCGGCCGGTGAAATGTCTTCATCTTTATCTGGCTTCAGTGACGCTGCTGAAACTGGTGATAAATGTTCTTCTCATCAGATTTTTCATTGTTCCTTCTGTCGGTTCTGTGTGAATTCATGTTTCGTTTTGGTGTAAAGAAGTGAAGAGTGTCGATATCAACACAGTTCTTGAGTTTATTGATCCTCAAAGTGCTGCAGGCGTGTGCGCCTGTGTTTGGTCTTGGGAATCAGAGCACGCACCTTGCGTGTGTTGTGAAAGTGTGTGTTTGTGGCTGTATTGACTTGTGTGTGTGCTGTATGTAGTTGTAAGTGTGAGTGTGTTTGTTCTGGACGACTCGTTTCGCTCCATTGGGTTCCTGTCAGCTCTCTGTATTCATTTGAATGTAGGCATCAATCTCTCTGGGCTTCTGTCTGTCGCTCTTCTGCCGTCTGCTCACTCATCTCCAAATGTGTGTGTGTGTGTGTTTCAGCAGGCATGTAATATTAATCATGTGCTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa6946
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112301 Essential Splice Site 873 994 17 19
ENSDART00000133056 Essential Splice Site 873 947 17 18
Genomic Location (Zv9):
Chromosome 4 (position 22340240)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 23683575
GRCz11 4 23404550
KASP Assay ID:
554-4796.1 (used for ordering genotyping assays)
KASP Sequence:
TACAMRTTTTTGCAGTYCACATCATGGCCATGATTGTTTTGTTGTTYGCA[G/T]GCTCCTGAATCTGTCCCTCACGTCAGACCTGGTGCCGGATCAGGATGTAA
Long Flanking Sequence:
TGAAACTTGGAGAAAATTGTTGTGAATTGAGTTGTGAAATATTTAGCAAAAAGGTCTTTTAGGTCTTTTAATTTACTGTATGTTAAAATAATTTGTATTCTTTATTGCAAATGGCAAAGGTGCATTTACACAAAAGGAAACTTTTTAGTTTTTGAAGGAACACATTTAACACTGTTAAGGTACAAAGTATCTTGTCACTGTAGTGATACTTTCATGGATCACATTTGCACCATTGATGAAGGTACAATATTGTATCTGCAGGTTTTAAAACCAAAGGTACGTTTTGGTTTTCCATGGTACAAATCATGTCTTTAAAAGGTACAAACTGCAATGGTACAAATTTGTTTCTTTGTTTTAAGATACAATTCTGTTCCATAAAAAGGTACTGCGCCAGTGACCAGCTTTTATACCTTCTTTGGTACAACATTGTATCATTTTTTTCTGAGAGTGTACAAATTTTTGCAGTCCACATCATGGCCATGATTGTTTTGTTGTTCGCA[G/T]GCTCCTGAATCTGTCCCTCACGTCAGACCTGGTGCCGGATCAGGATGTAATTGATGTCATCATACATGTGGCCCGCAATCCACTGGGAAGACATTTAGCATGGAGATATTTCAGAGAGAAGTGGGACATTTTGAACTCCAGGTGAATGTAGCTCTACTCATTCCTGCTCATAAAACCTTCCTTTCAGTCCCTGATATGAATTTTACATCCACACTCTCATAAGATATATATTGGTGAATGTTTCTGGTTGTTAGCGTTTGAAGGACCAGAATGCATCTATTGGTGTTTGTTTACTGTTTGGCTGATTAAAATGTTCTCAGCTGTTTTTAATAAAAGACTTGCGTCTCTCAATTGCAGGTATGGAGAAGCTTTATTTATGAACTCAAAATTAATCAGCGGCGTGACAGAGTTTCTCAATACTGAGGCCGAATTGAATGAGGTGAGTCTGGATTTATACTCTATCCTGAGGCAAATTAACTAAAAACACTAATGAGCTATTG
Associated Phenotype:
Not determined