Busch Lab

ZMP

sez6l

Ensembl ID:
ENSDARG00000076028
ZFIN ID:
ZDB-GENE-091204-162
Human Orthologue:
SEZ6L
Human Description:
seizure related 6 homolog (mouse)-like [Source:HGNC Symbol;Acc:10763]
Mouse Orthologue:
Sez6l
Mouse Description:
seizure related 6 homolog like Gene [Source:MGI Symbol;Acc:MGI:1935121]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa21892 Essential Splice Site Available for shipment Available now
sa12945 Essential Splice Site Available for shipment Available now
sa12754 Essential Splice Site Available for shipment Available now
sa9202 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa45426 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa21892
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114839 Essential Splice Site 414 937 6 17
ENSDART00000141454 Essential Splice Site 232 755 4 15
Genomic Location (Zv9):
Chromosome 11 (position 21621953)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 44803733
GRCz11 10 44650345
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCGGCTGCACCTACACCTGGAGAGAATGGTGTTGGGCACCACAGACAGG[T/G]AAACCCAGGTACCATCAACATCAATGCATGCTTCTCCTACGACAGCTCTG
Long Flanking Sequence:
AGCATCATAACAACGTAGTAACAACTTCTTATAAACTTAGCAACACCCTGGCAACAACCCAGAACACCATAGCAACATAGTAACAACTTCTTATAAACTTAGCAACACCCTGGCAACCACCAAGAACACCATAACAATACTGCAACAGCTTCTTATAAAATTTAGCAACAACCTGGAAACCACCCAACCTTTCAGTACCTTAGCAACACTTGACAGACCCTGAACACAATAACACAGAAACAAACTCTCAGAGTTTTCACAACCACCCAGTATAAGACAGTATTATAGTTAGCTTATTAATGCAATGTTCCATATGTTCTCGTCCAGCTCTGTGTGGCGGTGTTGTTAAGAACGCAACAGTGGGACGAGTGTTGTCCCCCTCACCCCATTCAGGCCCCAACAGCACTCTGGACCGCAGCTGCTCATGGTCTCTGGAGGCTCCAAGCGGCCAGCGGCTGCACCTACACCTGGAGAGAATGGTGTTGGGCACCACAGACAGG[T/G]AAACCCAGGTACCATCAACATCAATGCATGCTTCTCCTACGACAGCTCTGCTAGAATTGTTATGTTGGGGCTGTTTTTGCCCTATTGACTTCCATTATAATCACATTTTTGGATTACAAATCTCTGTGTCGTTCAGACTGACTCCCCTTTGGTTATGTTGGTTTGTTTTTGTCCCACTGACTTCCATTATAATCACATTTATTGATTGCAAAGCCATGGCACTCTTGATTGGTGCTGGTTTTCACTGTTGGACCCATCTAAAGGGATAATGATGACAACTGATGATCAACAGTAAAATGACAAATGTTACCTCTTAATCCTAACAGGGTAAATCAGCAGCAATCAGTAATGCATGATTATCTGCTGTCATGGCTTTGCAATCAATTAATGTGATTATAATGGAAGTCAATGGGGCACAAACAGCCCCCAACATAACCAAAGGTGAGTAAATCTTCCTCCATGATTTAGGCTTGTGTTATGGAGTGGTCTCGACGCTGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12945
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114839 Essential Splice Site 470 937 7 17
ENSDART00000141454 Essential Splice Site 288 755 5 15
Genomic Location (Zv9):
Chromosome 11 (position 21621314)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 44804372
GRCz11 10 44650984
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AACAGACCAGCCGAACAGCCACAACACCGGCTTCAATATACGATTTGAAG[G/A]YAGGCTGACAATGCACCGAGTAGATTCAATTCAATGTGCAATGGACTAAA
Long Flanking Sequence:
TGACTCCCCTTTGGTTATGTTGGTTTGTTTTTGTCCCACTGACTTCCATTATAATCACATTTATTGATTGCAAAGCCATGGCACTCTTGATTGGTGCTGGTTTTCACTGTTGGACCCATCTAAAGGGATAATGATGACAACTGATGATCAACAGTAAAATGACAAATGTTACCTCTTAATCCTAACAGGGTAAATCAGCAGCAATCAGTAATGCATGATTATCTGCTGTCATGGCTTTGCAATCAATTAATGTGATTATAATGGAAGTCAATGGGGCACAAACAGCCCCCAACATAACCAAAGGTGAGTAAATCTTCCTCCATGATTTAGGCTTGTGTTATGGAGTGGTCTCGACGCTGGTTCGGTGGTCCTGTTTGATTCTGGACGTGGAGGTCCGATCCCATTTGAGGGAGTGATCAGCGAAGGTCCGGCAGTTCGGGTTCAGTTTATAACAGACCAGCCGAACAGCCACAACACCGGCTTCAATATACGATTTGAAG[G/A]TAGGCTGACAATGCACCGAGTAGATTCAATTCAATGTGCAATGGACTAAAAATATTTACAGTATTTATCCCACTTGGACGTTAAATATGGAAGGTAAATCCTGCCAATTTTAAATAAATCAAATAAACATTGGAAATGAAAATTAAATGAAATTATTTAGTTTTAATTTTCACTTTGACAACACATCGTCCCTGTCAAACTGATAATTAAAATGAAGTTGCCGATTTAACATTTCATTTTCCCTGCATTTCCGCATCAAGACTGCCAATATTAAAATGAAAAGCCAAACTGAAAAATAAAATGCAAACACAATTTTTACACAGCGTGTTATTAATGTTCACGCTATAATAGTGACACAATTCAAATGAAAATGTAAATTTAAGCTTTCCTTTTATTGACACTTTTTCATTTCAGTTTTCATTTTCGATTTCATTTTCAACTTAAAGCTGTATGCAAAGCCTATGCTAATCAGTGGGAGGGGCGTATTCGAGTGACGTCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12754
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114839 Essential Splice Site 471 937 7 17
ENSDART00000141454 Essential Splice Site 289 755 5 15
ENSDART00000114839 Essential Splice Site 471 937 7 17
ENSDART00000141454 Essential Splice Site 289 755 5 15
Genomic Location (Zv9):
Chromosome 11 (position 21621313)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 44804373
GRCz11 10 44650985
KASP Assay ID:
2260-4199.1 (used for ordering genotyping assays)
KASP Sequence:
ACAGACCAGCCGAACAGCCACAACACCGGCTTCAATATACGATTTGAAGR[T/C]AGGCTGACAATGCACCGAGTAGATTCAATTCAATGTGCAATGGACTAAAA
Long Flanking Sequence:
GACTCCCCTTTGGTTATGTTGGTTTGTTTTTGTCCCACTGACTTCCATTATAATCACATTTATTGATTGCAAAGCCATGGCACTCTTGATTGGTGCTGGTTTTCACTGTTGGACCCATCTAAAGGGATAATGATGACAACTGATGATCAACAGTAAAATGACAAATGTTACCTCTTAATCCTAACAGGGTAAATCAGCAGCAATCAGTAATGCATGATTATCTGCTGTCATGGCTTTGCAATCAATTAATGTGATTATAATGGAAGTCAATGGGGCACAAACAGCCCCCAACATAACCAAAGGTGAGTAAATCTTCCTCCATGATTTAGGCTTGTGTTATGGAGTGGTCTCGACGCTGGTTCGGTGGTCCTGTTTGATTCTGGACGTGGAGGTCCGATCCCATTTGAGGGAGTGATCAGCGAAGGTCCGGCAGTTCGGGTTCAGTTTATAACAGACCAGCCGAACAGCCACAACACCGGCTTCAATATACGATTTGAAGG[T/C]AGGCTGACAATGCACCGAGTAGATTCAATTCAATGTGCAATGGACTAAAAATATTTACAGTATTTATCCCACTTGGACGTTAAATATGGAAGGTAAATCCTGCCAATTTTAAATAAATCAAATAAACATTGGAAATGAAAATTAAATGAAATTATTTAGTTTTAATTTTCACTTTGACAACACATCGTCCCTGTCAAACTGATAATTAAAATGAAGTTGCCGATTTAACATTTCATTTTCCCTGCATTTCCGCATCAAGACTGCCAATATTAAAATGAAAAGCCAAACTGAAAAATAAAATGCAAACACAATTTTTACACAGCGTGTTATTAATGTTCACGCTATAATAGTGACACAATTCAAATGAAAATGTAAATTTAAGCTTTCCTTTTATTGACACTTTTTCATTTCAGTTTTCATTTTCGATTTCATTTTCAACTTAAAGCTGTATGCAAAGCCTATGCTAATCAGTGGGAGGGGCGTATTCGAGTGACGTCGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9202
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114839 Essential Splice Site 471 937 7 17
ENSDART00000141454 Essential Splice Site 289 755 5 15
ENSDART00000114839 Essential Splice Site 471 937 7 17
ENSDART00000141454 Essential Splice Site 289 755 5 15
Genomic Location (Zv9):
Chromosome 11 (position 21621313)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 44804373
GRCz11 10 44650985
KASP Assay ID:
2260-4199.1 (used for ordering genotyping assays)
KASP Sequence:
ACAGACCAGCCGAACAGCCACAACACCGGCTTCAATATACGATTTGAAGG[T/C]AGGCTGACAATGCACCGAGTAGATTCAATTCAATGTGCAATGGACTAAAA
Long Flanking Sequence:
GACTCCCCTTTGGTTATGTTGGTTTGTTTTTGTCCCACTGACTTCCATTATAATCACATTTATTGATTGCAAAGCCATGGCACTCTTGATTGGTGCTGGTTTTCACTGTTGGACCCATCTAAAGGGATAATGATGACAACTGATGATCAACAGTAAAATGACAAATGTTACCTCTTAATCCTAACAGGGTAAATCAGCAGCAATCAGTAATGCATGATTATCTGCTGTCATGGCTTTGCAATCAATTAATGTGATTATAATGGAAGTCAATGGGGCACAAACAGCCCCCAACATAACCAAAGGTGAGTAAATCTTCCTCCATGATTTAGGCTTGTGTTATGGAGTGGTCTCGACGCTGGTTCGGTGGTCCTGTTTGATTCTGGACGTGGAGGTCCGATCCCATTTGAGGGAGTGATCAGCGAAGGTCCGGCAGTTCGGGTTCAGTTTATAACAGACCAGCCGAACAGCCACAACACCGGCTTCAATATACGATTTGAAGG[T/C]AGGCTGACAATGCACCGAGTAGATTCAATTCAATGTGCAATGGACTAAAAATATTTACAGTATTTATCCCACTTGGACGTTAAATATGGAAGGTAAATCCTGCCAATTTTAAATAAATCAAATAAACATTGGAAATGAAAATTAAATGAAATTATTTAGTTTTAATTTTCACTTTGACAACACATCGTCCCTGTCAAACTGATAATTAAAATGAAGTTGCCGATTTAACATTTCATTTTCCCTGCATTTCCGCATCAAGACTGCCAATATTAAAATGAAAAGCCAAACTGAAAAATAAAATGCAAACACAATTTTTACACAGCGTGTTATTAATGTTCACGCTATAATAGTGACACAATTCAAATGAAAATGTAAATTTAAGCTTTCCTTTTATTGACACTTTTTCATTTCAGTTTTCATTTTCGATTTCATTTTCAACTTAAAGCTGTATGCAAAGCCTATGCTAATCAGTGGGAGGGGCGTATTCGAGTGACGTCGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45426
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114839 Essential Splice Site 648 937 10 17
ENSDART00000141454 Essential Splice Site 466 755 8 15
Genomic Location (Zv9):
Chromosome 11 (position 21612600)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 44813086
GRCz11 10 44659698
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCGGCCTGGTGTTCGGGAAAGGCGAAGGCTTCATCATCAACTACATGGG[T/A]AAGAGACTCTCCATTCATTCACTTTCCTTCAGCTTAGTCCCTTACTTATC
Long Flanking Sequence:
ATTATTATTAGCTCCAGAACTGTCTTGAGCATCTGTCTGCGCTCCCAAAGAGCATCTCACTCCTCTAAAAGCCACCTTGTTCATAGCGTTTTGTCTTTGTTTTCTGAGTCGCAGCTGATTGTCATCATAAAACACTTCTCTCTCTGATATTTGCCTCCAGGTTTATCAAGAAGTGACCCTTTTGTTTCTCGTTGAATGAAAGCGCTGTGTTATTCGCTCATTTTTCATGCTGTATTCCAATTTTGTGCACACATTTGTTTCATGTATTTGCATGTAAACCCAGCTGTTATCTCCTCCGTCAGGCTGAATCTGAGCGATAGTGATATGCTCACTATCCTGGATGGGGATGAAGTCACCACACGTATTCTGGGTCAGTTTGTGGGCGGCACGAGTCCCTTTAAGATGTCGTCCTCCAGCCCAGACCTCACCATCAGCTTCCACTCGGACCCGGCCGGCCTGGTGTTCGGGAAAGGCGAAGGCTTCATCATCAACTACATGGG[T/A]AAGAGACTCTCCATTCATTCACTTTCCTTCAGCTTAGTCCCTTACTTATCAGGGGTCGCCACAGCGGAATGAACCGCCAACTATTCCAGCATATGTTTTACACAGCGGATGCCCTTCCAGCTGCAACCCAGTACCCAGTACAAACACACTCATTCACATACACTAAGGACAATTTAGTTAATCAGTTCCCCTATAGCGCATGTGTTTGGACTGTGGGGGAAACCAACGCCAACACGGGGAGAACATGCAAACTCCACACAGAAATTACAACTGATCCAGCTGGGACTCGAACCAGTGACCTTCTTGCTGTGAGGCAATCAGACAGCTGATTTTTACATACGTATATAAATAACTATCAGATATAAAACAATATACTGAATACAACACTAATAACTTGATCATCTTTTGCATTAAATATATGCATCAGTTTTCCCACCTATAGACAAGCTTTCAGTCTAGAATTGGCGTCTCACACACACACACACACACACACACACACA
Associated Phenotype:
Not determined