Busch Lab

ZMP

DGKZ (2 of 2)

Ensembl ID:
ENSDARG00000076025
Description:
diacylglycerol kinase, zeta 104kDa [Source:HGNC Symbol;Acc:2857]
Human Orthologue:
DGKZ
Human Description:
diacylglycerol kinase, zeta 104kDa [Source:HGNC Symbol;Acc:2857]
Mouse Orthologue:
Dgkz
Mouse Description:
diacylglycerol kinase zeta Gene [Source:MGI Symbol;Acc:MGI:1278339]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa10033 Nonsense Available for shipment Available now
sa38004 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa45845 Nonsense Mutation detected in F1 DNA Not yet available
sa24608 Essential Splice Site Available for shipment Available now
sa38005 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa44233 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa9720 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10033
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108625 Nonsense 24 1107 1 35
Genomic Location (Zv9):
Chromosome 25 (position 8068736)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 7681260
GRCz11 25 7805352
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGCATTTTAAGAGAAAGGAAGCAGGGGACGGTGTGCATGATGACTCCTGT[C/T]GACACCGGAGRCCGAGCATTGCAGTGCCAACCAGCCGTGCCCGACGGCGC
Long Flanking Sequence:
TATATTCACTAACAAAAAGGGGTATACTCAATTATGCTGAGCATATGTACTTATTGATACTTACAATGGTTAAAAAAAAAAGTAAACAGAAAAAAGTTGCATTCATGACATATGTTGCATATGTGAAATCCAAATATGAACTTAGTATTGACTTCCAAAGATCAGATTTCTATATGATGCCTGATGTGACATGTATTATAGATAGATAGAGGTTGTCTCTGTTTGTGATGACATTGAAAAGAACGGGCAAGCGTTGAGTTAGATCATCTCAATTTTAGGGATTAGCTCTAAATCTTGGTCGATGGAGGTCAGTGTGACAAGCTTTCAGTAGTCTTAGAGCGTGGTGTTAAAATCTATGCTGACAGGCTACAATTTTCAACCAACAGCCTCTGGGGGGAACTTTATAAAGAGAGCGCTATCCTCCAGCCACCATGGACACTTTTTTCCGACGGCATTTTAAGAGAAAGGAAGCAGGGGACGGTGTGCATGATGACTCCTGT[C/T]GACACCGGAGACCGAGCATTGCAGTGCCAACCAGCCGTGCCCGACGGCGCTCCAGTGTCGGCCTCCCATCCAGTGCATTAACCCAGCGGCGCCGATCCAGCGTCCAACTTCAGGCATTGCCCCGAATCAACAGCAGTCAACCGGTACATCAAAAGAGCAGCGGTAGACGGAGGTCAAGTACCACCACCCTGAAAGCCAATCCTCGCTTTGCTGTGCGCCGTAAGAAAGTAGGCAAGCTTCGCAATATAGACACACACCTCCTAGGCCCATCCATGCTGCTAGCCAGTCTGATCCAAATGACTCAAGAAGAGGAAGACGATGAAGAAGGTCGCAGTCCGCTCCCAGGGCAAGTGGAGCTCAAGGGAAGCAGCTCGAAGTTCAGGAGTCACACAGATGTGCTGCTTTCTGAAGGTGACAGTGATAGTGATGACTCCAGCGAGCATTCAGAGGAACGTCAATACTCAAGGATACGCAAAGAGTGTCTGGAGGAGGCTGATGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38004
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108625 Essential Splice Site 258 1107 5 35
Genomic Location (Zv9):
Chromosome 25 (position 8078174)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 7690698
GRCz11 25 7814790
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGCTAAAAGTGAACCCAACAAAAAGATATGCAACACCGTGGATTGGACC[G/A]TGAGTTACTCGTCTGTATTTTACCAACAAGTAGGCCTGTCACAATAATCT
Long Flanking Sequence:
TGAAAGCACCTACTATACTGTATGATTTTTGAGCGAGAACAAGAATCTTGTAACATTGATGAGCTAAATAATACAAGCCAAGCATAATGTATACACAGTGTACATAAAGATTAGAAGCAGAAAAACCTACAGATGTCCAAGCCATGCTCTATAGCGCTCTGTGTGGGTTGCTGCTGGTAAAAATAACCGTATTGATTGATACGGAATTAAACAAGTGCAATTTAACAAGACCCCCACCGCTCCAAGGCATTATGAGAAAGCTGCCAACCTTTCAGGGACAAAATAAATGTTCCTAATTTTATTGTTTGTGTGCTGTAATTGACTTAATTAAGATATGATTTGCACATCTGCTTAATATCACTGCCATGTTTTCTTTTTTTTTTTTTCTCAGGAAAGCCATCGCCAAAGCTGGTGTGCAGGATAACGCTGCTCAATCCGGCACAATAACACCTGCTAAAAGTGAACCCAACAAAAAGATATGCAACACCGTGGATTGGACC[G/A]TGAGTTACTCGTCTGTATTTTACCAACAAGTAGGCCTGTCACAATAATCTATGTATCGACTTATCTCACAATGCAAAGACATGACCTCAATCGTTTTGGTGATGCAATACACAGTTGAAGTCAGAATTATTAGCCCCCTTTGAATTTTTTTTTTCTTTTTTAAATATTTCTCAAATTATGTTTAATAGAGCAAGGAAATGTTCACAGTATTTCTGATAATATTTTTTATTTTGGAGAAAGTCTTATTTGTTTTATTTCGGCTAGAATAAAAGCAGTTTTTAATTTTTTAGGAACCATTTTACAGACAAAATTATTAGCCCCTTTAAGCTATATTTTTCGATAGTCTACAGAACAAACCATCATTATACAATAACTTGCCTAATTACCCTAACCTGCCTAGTTAACCTAATTAACCTAGTTAAGCCTTTAAATGTCACTTTAAGCTGTATAGAAGTGTCTTCTATAAAATATCTAGTCAAATATTATTTACTGTCATCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45845
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108625 Nonsense 279 1107 6 35
Genomic Location (Zv9):
Chromosome 25 (position 8086434)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 7698958
GRCz11 25 7823050
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGGGTCAACACGTGTGGTTTGAGACCAGTCCGGCAGGAGATTTCTGTTA[T/A]GTGGGGGAGTCAAACTGTATCGCAAAGTCCCAGGTAGACACATATTGTAG
Long Flanking Sequence:
GGTTATTTACTTGGGTTTTCATTTTTACTGTCAGATTCCCAAACCAAACAATAATCCCATATCTTAAAATAGACTCTATTGTTGCTTTATAAAAAGTCATCATTATGCTGCTACTCACTCCAAATAATCTTAATAATCATTTGATTTCAATGTACCTACAGAAAGGTATCCGATAAAGCAGTATCCATATAGAGCATTTTGAGGCATGTAAACGATTGTAATGTATTTCCTGTTTTACATTTAGATAGCAAATGAGGATCCAAAGACAGCCACATATTGATAAATAATGTTATGATAGCTGTTTTACGTTATGATTGAATTGCCTTGTTACAGTTATGAATTGGTTTGATAAGCAGGAAATGTTCAAGAGCAAATGACATGACAACATTGAAATGTTCTATAGCAGTAAGCACTCATTAATCTTTTGGTTTTCCACAGGAAAATGCCCAGTTGGGTCAACACGTGTGGTTTGAGACCAGTCCGGCAGGAGATTTCTGTTA[T/A]GTGGGGGAGTCAAACTGTATCGCAAAGTCCCAGGTAGACACATATTGTAGTGATTCTTAAAACAATCATCAGCAAAAATGAGCAGTGTGTATCGAAAAACCCTGCACAACAGCTCCCTCTTCTGGTTAGATGTTCTATATGCATTTAGATAAATCGCTAAGATGCTAATTACCATTTCGTTTTGTCCTCACAGCAAAAGTCTCTTCCCCGCCACAAATGTGCAGCTTGCAAAATATCAGTTCACACAGAGTGCATGAATCAGCTGGACAAGGTTAGAAGTTTGTAGAAACAACTTTTGAACGATTTGGGGTGTAATAACAATGTATCTTCTCAAAGGAAAATGTGCGCTTTCCCTACAGATTAACTTCAGGTGTAAGCCAACTTTTAAAGATCCAGGGACGAAAAATGTCAGAGAAGTAAGACTTTTTGTCATTTTATATCAAGCTTTTTATATATTTCGCTCTGCATAAATGAGTACACCCCCTCACAGGTCCTTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24608
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108625 Essential Splice Site 610 1107 17 35
Genomic Location (Zv9):
Chromosome 25 (position 8097361)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 7709885
GRCz11 25 7833977
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTAATTTAGAGGCCAGCGATGAGGACAAAGATGAACAACAGACCGACAAG[G/T]TGAGCTGACACCAGCAGAGGGCGCAAGACTTTAGCAGAAGAACATCTGCA
Long Flanking Sequence:
CATCTCTGGGAAATGTTTACACATATATATACATAAATGAACACCATTAAACATGTATATATGATGTAAATACAAACTTTTATCCTCGACGCAATTAATCGTAATCAATCTTTGCCCAGCACTAATATAAATATTTATATACACAAATTACTTGTTTGAGCGCACTATTTACTATTATTTTTTTGCATCTTTAGTGTTTTAAATAGTGTTGAATTTTTACAAAGAATGCATGGTAACATCTAACTCGTGTAACTTTATTAAAGACACAAACTAATAATACTGAAGCGATCTTAAAGCTGCAGAACAAGAGAAAAAGAAACCAGTTTTGTTTTCCTGAAAATGTACCTGTTGACATCAAGGGCTACACAGATGAACCAGTATCCAAGATCCTTTCCCATGTTGAAGACGGCATCATCGTCCAGCTGGATCGCTGGAACCTGAGTGTGGAAGCTAATTTAGAGGCCAGCGATGAGGACAAAGATGAACAACAGACCGACAAG[G/T]TGAGCTGACACCAGCAGAGGGCGCAAGACTTTAGCAGAAGAACATCTGCAACAAAGCCAGAGTTTTTAGAAGCTCCTTTATGTTTAGGCCTGTCACGATAATCAGTATATCGACTTATCGGGCAACACATGGACATGACCTCAATCATTTATGGTGGCACAATATATATATATATCTCTCATACATAAAACAATTCAAGCAACATTTTAGCTGATTGTGCAACATCTCTTTTAAGAAAACACTATAGTATTTACTTGAAATTACTATAGTATGTTGTGATGTGGATGCCTTACAACTGAACATAGAGCAGATATCACAGCCTTTGTTATTTTTTACGTTGCACTTTGTTGTTTGCATTTATTATTATTTGTTTAGGATATGCGTTTTCACATTTTGACTCCAATGCCTAATTATTAAATTGTTAAAATAACTATAATTAATTGGAATATTCTTAAAAACAAAATATTGTGTTCTTTGGAAGAGTGAACTTGCATTATGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38005
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108625 Essential Splice Site 637 1107 19 35
Genomic Location (Zv9):
Chromosome 25 (position 8098693)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 7711217
GRCz11 25 7835309
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGGTTTGTTAAAGGCTTCAGATCTTTTAAGATGCCGTTTTGTTATTTC[A/G]GAGGCTAAACCGGAACGCTTCAACAGTCGACTTCGCAATAAGATGTTTTA
Long Flanking Sequence:
TTCAAATATTTCCCAAATGATGATTAACAGAGCAAAGAAATTTTCACAGTATTTCCTATAATATTTTTTTCTTCTGGAGAAAGTCTTATTTGTTTTATTTTGGCTAGAATAAAAGCAGATTTACATGTTTTTAAAGCCATTTTGAGGTCAATATTATTAGCCCCTTTAAGCTATATTGTTTTTCAATTGTCTACTGAACAAACCTCTGTTATACTATGACTTGCCTAATTACCCTAACCTGCCTAATTAACCTAGTTAAGCCTTTAAATGTCACTTTAAGCTGTATAGAAGTGTCTTGAAAAATATCCAGTAAAATATTATTTACTGTCATAAAATAAATCAGTTATTAGAAATGAGTTATTAAAACTATTATGTTTAGAAATGTGTTAAACAAACATTCTTGCCGTGTAACAGAAATTGGGGAACAAAATACAATTCTGACTTAAAATCTGTGGTTTGTTAAAGGCTTCAGATCTTTTAAGATGCCGTTTTGTTATTTC[A/G]GAGGCTAAACCGGAACGCTTCAACAGTCGACTTCGCAATAAGATGTTTTACGCAGGGGTGAGCATATCTATTAAAGTGCTGTTGACATTTTATGCTACTTGTATCATTTTAAATGTAATGTATATGTTTTAAAACCTATTTCTTTCTACAGACAGCATTCTCAGACTTCCTGATGGGCAGCTCTAAAGATCTGTCCAAACACATCAAGGTTGTGGTAAGTTGAATTTAGTTTTCTTTTGTCTTATTTCTAGTCCAAATATCCTACAAATTCTTAAATCAAGAAGCATTTTCTAGACAAGCAAAACTTATTGTCTTGTTTTATGAAAAAACATGTCAAAATGAAGTTTTTCCTTAAAAGGAGCAAAATAATCTGCCAAATGGGGTAGGCAAAATAATCTTATGTCAAAAAGAAAAACAAGCTTATTTTATTTACCCCATTGGCAGATTATTTTGCTTCTTTTAAGGAAAAAAAACTCACTTAATTTTTGCGTATTATTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44233
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108625 Essential Splice Site 865 1107 25 35
Genomic Location (Zv9):
Chromosome 25 (position 8108108)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 7720632
GRCz11 25 7844724
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGAACAGTGATTTGGAGACGTGTCGGCAGCATATCGAGAGGTTGCATGAG[G/T]TGCTTTTCAGCTTGTTGAATGCTTGCGAGAAATGCGCCAGCAGTGAGAAT
Long Flanking Sequence:
CACTTTAGAATGTCCACAATGGTTTCTGTCACCACGACACAAATGGATGCTCTCTAAGATACTCTCTAAGTGCATTAAAGGGGTGATGATTTTGGATACAGCCTTGGTATATTATTTCACTGAAAGACACCGGTCCTCTTAGACCATGTAAGGTGACGCCTGATCTACTTTAAAATGCAGCCCTTACATACATTTTCTTTCTCTTTATTAATGTAGTCAGCAGCCCATCGCAGAGACAGTGCAGATCCAAGTGAACCGTATCAGTATGCATGATTATGAAGCTCTCCATTATGATAAGGAGCAGCTCAAAGAAGCCGGTGAGTATTTCTTCTTCACATCTTCGCTCTTATACACTGATGTACTCTTGCTTTTGAAATACTAGAGACCAGTCCTAACATGTGTGTTCTGTTTTCCTTTCAGCGATTCCCATGGGGATAATTACAGTTCCTGGGAACAGTGATTTGGAGACGTGTCGGCAGCATATCGAGAGGTTGCATGAG[G/T]TGCTTTTCAGCTTGTTGAATGCTTGCGAGAAATGCGCCAGCAGTGAGAATTGGCAGCAACCTCCTTCCTCATTTGTGAAGGTTAAGAGGAGGATCTGAACTATCAAAACGTGGCTCAAAGTCAACATGAATCAAAAACTGACTTTGTTAAAGGGCTAGTCCAGCTAAAAAGTAATGTCTGTTATTAATTAGTCACTAATATGTTGTAATATCCTGAGATCGTTGTTAGATGATATCCAGGAGCTCTCTAAGCCTCTATAGACAGCAAGATGTTGACAAACATTGGCAAAATATTCCATGTATAAAATATTCCGCCACAGTGGAATGAACCCCCAATTATTCCGGCATATGTTTTACACCCATCCACTCATGCATTCACACACACATACACTACAGCTAATTTAGTTTATTTAATTTACTTTTATCGCATGTCTTTGGTCTCTGGGGGAAACCGGAGCCCCCAGAGATAATCCACCTGTATCGTCGCCTTTTCTCCCACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9720
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108625 Nonsense 897 1107 27 35
Genomic Location (Zv9):
Chromosome 25 (position 8113721)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 7726245
GRCz11 25 7850337
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTTTCTCTTTGTTTGTTTGTTTCCCAGGTACAACTGCAGATCGTTTCTAC[C/T]GAATAGATCGTGGTCAGGTACTTTGACRYTTTACATCTCTATTACGCGAC
Long Flanking Sequence:
CATTTCGGTCACGGCCGCCTGCTTTGAGAGCCTTTCTGAATGAATGTGTTTTTCCAACAAGGCAACCCGAGGTGCTGTAATATAATTGGCTAAACTGCGAGGTGGGTTTAAAGAACCAAAACAAAAGACAGCGTTCTGGCACAAAACGCACATTTGTAAAGCAGAATATTGTTTAACGTAACGTTTTTAGTCCGTTGGATTGATATAAGTGGAGATGAATAGAAAAGTTAGTTTGATTTAACAAAAAAATTGAAGGTAGCTAGAATTTACAGTGTAACTAATAATAAAAAATAGGTAACTAGTATATTAAGCTAGTAGTGTTCGTTAATACCATGAATTGTTTACTAAAGTGTTTTCAAAAGTGTGATAATGATGTATAATTAATGTGAAATTGTATCTGAGATTCTTCAGTTTTGACCTTTCCACTAGTTTTAAGTGCCACAAACAAATCTTTCTCTTTGTTTGTTTGTTTCCCAGGTACAACTGCAGATCGTTTCTAC[C/T]GAATAGATCGTGGTCAGGTACTTTGACACTTTACATCTCTATTACGCGACACACTGTGCTGTTTTTTTTTACCCTACAGCATTGCATGTCTCCGCAGGAGCATCTAAACTATGTGTCGGAGATCTCCCAGGATGAGCTTTTCATCTTGGACCCGGAGCTGGTCACCAAGGAGACGGTGGGCACGTCGCCCGGAATGCCGGGGGCGATGGAAACGGTTGTTGGGGGATGTGGATGTTCCAACAGCACAGACCAGTTCGCTTTTCCTGCCTGCTCTCCAGGGCCTTCTCCACTCTGCAGGTAGATTGAAACCAGTCACTTTGGATGACAAAATGTGCAGTTAAACTGGATCAGCTCATGTTGTTAAAGCTGCAAACAGCCTCGAGGTGCAGTTTTATGTCGCTTTTTTTATATCCGCGGATCGTTTTAACACATAGACTAGCACAGTAATGCGTGGGCAGGATGTGCTTCGCCTGTGGGCATGAGATTTCTGAAAATGTCCC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30204
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108625 Essential Splice Site 1036 1107 33 35
Genomic Location (Zv9):
Chromosome 25 (position 8124737)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 7737261
GRCz11 25 7861353
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTGATAAACAGCTCCTGCCTGCATACTGGATGTGACGGAGAAATCAAC[G/T]TAAGTACTGCTAAAGCCACTTTTATTCCATTTAATCAGTGGCGGATTTAA
Long Flanking Sequence:
GAAAAAAAATTCAAAGGGGGCTAATAATTCTGACTTCAACTGTGTGTATGTATATATAATTCTATAATACATTTAATTAACTATTAACCAATTTAGTACAATTCAATAAACTCTTGTTTTTCAGATTCAACCAATTTGCTCTTTGATGCTGTGAAGTCTGGCAACTTGGAAAAGGTATTCATTTAATACTCAGTTCCAGTTGTATTATATATGAGGATTATTCGACCTCATGTTCTGTTTCTCTGCTTGATGTTTTCCTCAGTTGGAACAGATGCATGAAGAAGGAGCGGATCTCTCGGTCCAGGACCATTTAGGTTGCACCATCCTCCATCAGGCAGTCATTTTAGGTCACAAAGAGATTGTGAAGTTTATCACTGAAAACGGTGAGGTTCGCTTTTACTTCACTCTTTGACTTTGTGTGTTTTATTTCTGATCTTTTTTTTTTTGATTTTTTGATAAACAGCTCCTGCCTGCATACTGGATGTGACGGAGAAATCAAC[G/T]TAAGTACTGCTAAAGCCACTTTTATTCCATTTAATCAGTGGCGGATTTAATTTAAGCAGCTGAAATCAGCATGATAATGATTAGCTGTTGTTTTTCACTTTTTTTTTGGTCTTAGAGGAGAGACAGCTCTGCATAAGGCAGCTGCGTTGTGCCATAGAACAATTTGCTGTTATCTGGTGGATGCTGGTGCATCGCTCATGAAGACAGATCTACAGGTGCGATCCCACACCTCATCTTTATTGCTTTTAAATGATTGCTAGATACATCAGATACACTGTAAAAAAAAAAAAAAAAAAGCAATTCATTTGTTTGACTTTAAAAGGTAAAGTAAATGCATTGCTTTTAAAGAGATTATTTTACTTTACTTAAAAAAGTGAGTAAACCAATGGCTTTTAATGTGATTAGTTGACTTTACTTTAAAAAATGAGTAAACCCATGGCTTTAAAAGCAATTAGTTTACTTTACTTTTAAAAAGGTGAGTAAACCCATTGCTTTTAAAA
Associated Phenotype:
Not determined