Busch Lab

ZMP

ENSDARG00000076023

Ensembl ID:
ENSDARG00000076023
Human Orthologues:
SAMD9, SAMD9L
Human Descriptions:
sterile alpha motif domain containing 9 [Source:HGNC Symbol;Acc:1348]
sterile alpha motif domain containing 9-like [Source:HGNC Symbol;Acc:1349]
Mouse Orthologue:
Samd9l
Mouse Description:
sterile alpha motif domain containing 9-like Gene [Source:MGI Symbol;Acc:MGI:1343184]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa12784 Nonsense Available for shipment Available now
sa2116 Nonsense F2 line generated Not yet available
sa18746 Nonsense Mutation detected in F1 DNA Not yet available
sa19940 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12784
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108899 Nonsense 543 1424 1 1
Genomic Location (Zv9):
Chromosome 3 (position 6859291)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 6666359
GRCz11 3 6552199
KASP Assay ID:
2259-3008.1 (used for ordering genotyping assays)
KASP Sequence:
GAGGTAATGAGGACAAACARCATCAYGAARAGATCTTTTATAAGGGAGGG[A/T]AAGTGTCTTGGTGGAACTTCTACTTCTCAGAACAGCCCGGCTCRATGCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2116
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108899 Nonsense 847 1424 1 1
Genomic Location (Zv9):
Chromosome 3 (position 6860203)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 6665447
GRCz11 3 6551287
KASP Assay ID:
554-3161.1 (used for ordering genotyping assays)
KASP Sequence:
ACTTTGAGGGTGTGCGAGTGATTCACTCATGTATAGCTAAACAATGCTTG[C/T]AGGAGCTTTCAGCTTCTCATGGAGTGACGAAGGCAGAAATCACTAACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18746
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108899 Nonsense 850 1424 1 1
Genomic Location (Zv9):
Chromosome 3 (position 6860213)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 6665437
GRCz11 3 6551277
KASP Assay ID:
2259-3010.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGCGAGTGATTCACTCATGTATAGCTAAACAATGCTTGCAGGAGCTTT[C/A]AGCTTCTCATGGAGTGACGAAGGCAGAAATCACTAACATTCTGCTTACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19940
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108899 Nonsense 871 1424 1 1
Genomic Location (Zv9):
Chromosome 3 (position 6860277)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 6665373
GRCz11 3 6551213
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGACGAAGGCAGAAATCACTAACATTCTGCTTACAACAGAGTTATTTTA[C/A]GAGTACACTCTGGGAAAACAAAAATTAAGGCAGGATGTTCACAACATGCT
Associated Phenotype:
Not determined