Busch Lab

ZMP

si:dkey-39f8.1

Ensembl ID:
ENSDARG00000076020
ZFIN ID:
ZDB-GENE-070912-525
Description:
Novel protein similar to human and mouse pappalysin 2 (PAPPA2) [Source:UniProtKB/TrEMBL;Acc:B0UY77]
Human Orthologue:
PAPPA2
Human Description:
pappalysin 2 [Source:HGNC Symbol;Acc:14615]
Mouse Orthologue:
Pappa2
Mouse Description:
pappalysin 2 Gene [Source:MGI Symbol;Acc:MGI:3051647]

Alleles

There are 9 alleles of this gene:

Allele Name Consequence Status Availability
sa17244 Nonsense Available for shipment Available now
sa44537 Nonsense Mutation detected in F1 DNA Not yet available
sa32961 Nonsense Mutation detected in F1 DNA Not yet available
sa32960 Nonsense Mutation detected in F1 DNA Not yet available
sa39870 Nonsense Mutation detected in F1 DNA Not yet available
sa25852 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa32959 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa17244
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111730 Nonsense 424 1731 2 23
ENSDART00000135251 None None 94 None 2
ENSDART00000135536 Nonsense 225 841 2 8
ENSDART00000135892 None None 348 None 8
ENSDART00000146942 None None 104 None 2
Genomic Location (Zv9):
Chromosome 2 (position 34817560)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 35114270
GRCz11 2 35096727
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAAAAGCCACCAACCCCATTCAGAGAGGCAATCTCCGCTCTTGTCCCAAT[G/A]GGCAGATTTCTCAGAAGTTGAGAACCAGTGGGTGCCCTATAAAGATCGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44537
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111730 Nonsense 602 1731 2 23
ENSDART00000135251 None None 94 None 2
ENSDART00000135536 Nonsense 403 841 2 8
ENSDART00000135892 None None 348 None 8
ENSDART00000146942 None None 103 None 2
Genomic Location (Zv9):
Chromosome 2 (position 34817025)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 35113735
GRCz11 2 35096192
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGAAGCGGCGGGATGGAGTCTGCAACCCAGAATGCAACAGCATTCACTA[T/A]GATTACGATGATGGTGATTGCTGTGACCCTGAGGTTACAGATGTCGCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32961
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111730 Nonsense 670 1731 3 23
ENSDART00000135251 None None 94 None 2
ENSDART00000135536 Nonsense 471 841 3 8
ENSDART00000135892 None None 348 None 8
ENSDART00000146942 None None 104 None 2
Genomic Location (Zv9):
Chromosome 2 (position 34787295)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 35084005
GRCz11 2 35066462
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTAATAATTCGGCACGTGAGGAGCTGGCTGGAGTTGCCACTTGGCCATG[G/A]GCAAAAGAAGCTCTTACTCACCAAGGTAAGCTGTCCAGTTGCATGTAACA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8088
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111730 Essential Splice Site 841 1731 5 23
ENSDART00000135251 None None 94 None 2
ENSDART00000135536 Essential Splice Site 642 841 5 8
ENSDART00000135892 None None 348 None 8
ENSDART00000146942 None None 104 None 2
Genomic Location (Zv9):
Chromosome 2 (position 34778806)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 35075516
GRCz11 2 35057973
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CYGTCTCCATTCACTGGCTGAATCCAATCAGTGGGCCGCTTGCCCACAGG[T/C]AAAGTAAGGAGCATACATAATGCTGGCRAAGAGGAAATACATATTTATCR
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32960
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111730 Nonsense 862 1731 6 23
ENSDART00000135251 None None 94 None 2
ENSDART00000135536 Nonsense 663 841 6 8
ENSDART00000135892 None None 348 None 8
ENSDART00000146942 None None 104 None 2
Genomic Location (Zv9):
Chromosome 2 (position 34778021)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 35074731
GRCz11 2 35057188
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAACTGCCAGCTCTGCGATGAGAATGGAGCTCTCCATCAATATGCCCAT[G/T]AGGCCACTTCACCTCACGCTTGTGACTCCACTGGATACTGGACGCCAGAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa6853
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111730 Nonsense 1242 1731 13 23
ENSDART00000135251 None None 94 None 2
ENSDART00000135536 None None 841 None 8
ENSDART00000135892 None None 348 None 8
ENSDART00000146942 Nonsense 28 104 1 2
Genomic Location (Zv9):
Chromosome 2 (position 34748474)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 35045184
GRCz11 2 35027641
KASP Assay ID:
554-5385.1 (used for ordering genotyping assays)
KASP Sequence:
CTGTCATCATCTATCTGGCWTATGATGGTAGTTGGCWTGGAGAAAACTGC[A/T]AGAAAACAGTGACCATTGAACTCTGTGACACCAATGGGAAAAGACACTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39870
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111730 Nonsense 1492 1731 17 23
ENSDART00000135251 None None 94 None 2
ENSDART00000135536 None None 841 None 8
ENSDART00000135892 Nonsense 120 348 2 8
ENSDART00000146942 None None 104 None 2
Genomic Location (Zv9):
Chromosome 2 (position 34737736)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 35034446
GRCz11 2 35016903
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGGCATGACGTGGGAACTGTTTGCCGCTTCAAATGCAACCCAGGATATTA[T/A]GTCACTGGGACTCTCAACAAAAAGCCCAGAAAGTGAGTATTCGGTGTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25852
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111730 Essential Splice Site 1640 1731 20 23
ENSDART00000135251 None None 94 None 2
ENSDART00000135536 None None 841 None 8
ENSDART00000135892 Essential Splice Site 268 348 5 8
ENSDART00000146942 None None 104 None 2
Genomic Location (Zv9):
Chromosome 2 (position 34730131)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 35026841
GRCz11 2 35009298
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCCAGCGCTGATACAGTAGAGCACTGGATGGTTCCAACCAAAGTTCAGG[T/G]GAGGTGGAGGAGCCAGTTTGCAAAGTTTGTTTGATATCTTTGGTTTTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32959
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111730 Nonsense 1650 1731 21 23
ENSDART00000135251 None None 94 None 2
ENSDART00000135536 None None 841 None 8
ENSDART00000135892 Nonsense 278 348 6 8
ENSDART00000146942 None None 104 None 2
Genomic Location (Zv9):
Chromosome 2 (position 34727574)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 35024284
GRCz11 2 35006741
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTTTTCTCTCTTCTGTTAAGAGTATTGTCTGCACTGGGATGTTGAAGTG[G/A]TATCCGAATCCGGAGCAGATCCACTGCATTCAGTCCTGTGAGGTGAGTGA
Associated Phenotype:
Not determined