Busch Lab

ZMP

TRIM65 (77 of 82)

Ensembl ID:
ENSDARG00000076019
Description:
tripartite motif-containing 65 [Source:HGNC Symbol;Acc:27316]
Human Orthologue:
TRIM65
Human Description:
tripartite motif-containing 65 [Source:HGNC Symbol;Acc:27316]
Mouse Orthologue:
Trim65
Mouse Description:
tripartite motif-containing 65 Gene [Source:MGI Symbol;Acc:MGI:2442815]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa42294 Nonsense Mutation detected in F1 DNA Not yet available
sa38971 Nonsense Mutation detected in F1 DNA Not yet available
sa2717 Essential Splice Site F2 line generated Not yet available
sa13209 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42294
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056982 Nonsense 110 380 1 6
Genomic Location (Zv9):
Chromosome 13 (position 46758599)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 46054367
GRCz11 13 46190991
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTTTGTAAAGGAAGAAAACTCAAAGCCGTCAGGTCTTGTCTGGTGTGTT[T/A]GGCGTCATTCTGTCAAACTCACCTTCAGCCTCATTGTGACTCTGAAGCTT
Long Flanking Sequence:
AAAGGGCTACACAAACAGCCTGTTTTTACTTTTACTTTTGTTTCAGTGAAAACATTTTGTTTATTGCAAACTGAAGCCAGACCCTTCTACCTTGCATAAGTCACTCTCTGTTGTTTTTCTTCTCAGAACATACCCTGTTAATAAACAGTTTACTAAGAGAAAAAGCACCAAAATGGCAGAATCTTTATCTGATGTTCAAAATCCTTTTGACTGTTCGATCTGCCTGGAGGTGTTTAAGGATCCAGTCACTACACCTTGTGGGCACAGTTTCTGTATGAACTGTATTAAGGATTTCTGGGATAAGGAATCTCTTAAACCAGTTTTCAGCTGCCCAACATGCAGAAACAAATTCAATCCAAGGCCAAATCTTGGCAGAAGTGTTGTTCTTGCTGGCATTTTGGAAAAAAGGAAGCAGGACGTCCCAGCTGGACATGGAGATGTGCAGTGCGATGTTTGTAAAGGAAGAAAACTCAAAGCCGTCAGGTCTTGTCTGGTGTGTT[T/A]GGCGTCATTCTGTCAAACTCACCTTCAGCCTCATTGTGACTCTGAAGCTTTGAAAAAGCACAAGCTGGTGAACGCTTCAGCAAATCTACAGCAGCAGATCTGCCCTCAACATCACAAAGCTCTGGAGATTTACTGCTACGAGGACAAGAGGTGTATTTGTGTGCTTTGTTTGGGTCAACACAGAGGACATAAGACTGTATCAGCCGCAAATGAAATGCCAGAAAAAAAGGTAAAATATGTATTTAGTAATGGTAATGCTGTGTAAAATTGCTAATGTAAACTGTATTAACAAACACTGTAATGTTTTTAAGGGTATTCACTAAGTTACTAAGTGATATTTAAAAAATGTGAAAATATAATCCTGAGTAAGAATATGCAGACTGTTTCTGAAAGGGTTAGTTCACCCCAAAAAACTATATTATCTATATTAATCTGTTATAGTTACTCAGCCTCATGCCTTTCCAGTATGCTGAGACTATTGATCATTTTTAAAATTCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38971
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056982 Nonsense 167 380 1 6
Genomic Location (Zv9):
Chromosome 13 (position 46758428)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 46054196
GRCz11 13 46190820
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTGGAGATTTACTGCTACGAGGACAAGAGGTGTATTTGTGTGCTTTGTT[T/A]GGGTCAACACAGAGGACATAAGACTGTATCAGCCGCAAATGAAATGCCAG
Long Flanking Sequence:
AATGGCAGAATCTTTATCTGATGTTCAAAATCCTTTTGACTGTTCGATCTGCCTGGAGGTGTTTAAGGATCCAGTCACTACACCTTGTGGGCACAGTTTCTGTATGAACTGTATTAAGGATTTCTGGGATAAGGAATCTCTTAAACCAGTTTTCAGCTGCCCAACATGCAGAAACAAATTCAATCCAAGGCCAAATCTTGGCAGAAGTGTTGTTCTTGCTGGCATTTTGGAAAAAAGGAAGCAGGACGTCCCAGCTGGACATGGAGATGTGCAGTGCGATGTTTGTAAAGGAAGAAAACTCAAAGCCGTCAGGTCTTGTCTGGTGTGTTTGGCGTCATTCTGTCAAACTCACCTTCAGCCTCATTGTGACTCTGAAGCTTTGAAAAAGCACAAGCTGGTGAACGCTTCAGCAAATCTACAGCAGCAGATCTGCCCTCAACATCACAAAGCTCTGGAGATTTACTGCTACGAGGACAAGAGGTGTATTTGTGTGCTTTGTT[T/A]GGGTCAACACAGAGGACATAAGACTGTATCAGCCGCAAATGAAATGCCAGAAAAAAAGGTAAAATATGTATTTAGTAATGGTAATGCTGTGTAAAATTGCTAATGTAAACTGTATTAACAAACACTGTAATGTTTTTAAGGGTATTCACTAAGTTACTAAGTGATATTTAAAAAATGTGAAAATATAATCCTGAGTAAGAATATGCAGACTGTTTCTGAAAGGGTTAGTTCACCCCAAAAAACTATATTATCTATATTAATCTGTTATAGTTACTCAGCCTCATGCCTTTCCAGTATGCTGAGACTATTGATCATTTTTAAAATTCAAATGAAAATATTTTAAACCCTGCTCACACTGAGGTTTCAGACTTAATTTGTGAGACAATTTTTGGAAATCCTAAAAGATTCCTTAAATCCTAGGCTAAAATCTGTGATATTTTATCGTTGGTTTGACATGTTCACAGACAGCCACTTAATGCCCATTTTAATCAGATTTTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2717
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056982 Essential Splice Site 219 380 3 6
Genomic Location (Zv9):
Chromosome 13 (position 46754742)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 46050510
GRCz11 13 46187134
KASP Assay ID:
554-3377.1 (used for ordering genotyping assays)
KASP Sequence:
ATTCAATTTGTAATTTATTAGGCTAATAACCTATGTTRCTGTGTCCTGAC[A/T]GAGCTCTGCACAGGCAGCAGTGGAGCACAGCGACAGGATCTTCACTGARC
Long Flanking Sequence:
GGCCTCAGACACAATGCACTCAAATGGAACGAGTGACGTCACGGTGAGGGGTAGGGTTAGTGGTGGGGTTAGGTGAGCCCATTAAAAAGCATTGGATGCAGCTCAGATTGCACTGCACCAGGTCTGCATCCAGACCCCTCTCACTGAAACTCAGATCTAGGTTTTGCACCCCATTGCTTAATAAAAAGGTCCATTACCAGCATTGCTCTCTATAGACACCTAGTGACTGTGCTAAGAAATAGCAGACAAACCAATTTATCCTGAGCCAATGACCTGACCACACATTTGTCTATCAACTATAAATGATCAACCAGAAGTCAAGTCATTTTTTGCTGTTCTCAAAACTTGGATAGGCGACAAGACTTTTGTCAGGTAGCGTATTTATTGCCTGGGCATAAAATAAAATATTTATTTCTTTGTCCGACTTATTCAGAGACAACAGTCACACACATTCAATTTGTAATTTATTAGGCTAATAACCTATGTTACTGTGTCCTGAC[A/T]GAGCTCTGCACAGGCAGCAGTGGAGCACAGCGACAGGATCTTCACTGAACTCATTAGATCCCTTACCAAAAAACGAACTGAAGTGAGAGGAGAGATCAGAGCTCAGGAGAAAAGGGAGACTCAACAGATTATCGGTTACATACAAAAACGGGAACAGGAGATCAGCAATCTTCAGAAGCGGAATGATAAACTGGGGCAGATTTTGTGTACAGAAGATTACATTCATTTCTTCCAGGTATAAAAAAAGTATAAGAGATGCATTCTCTTTTTTTATTAAGTGCTCACTATTGACTCTATGAAGTCTTTTCCTCTCAAATTGCAGAATTACTCCTCTCACTCTACCAAAATACCATATACTTTACCAAAGAAAGTTCATGATGATCTCGTAACATTCAGGGAAGTAGATCAATCTGTCTCTGAGCTGAAAAGAAAACTGGATGAAGTCTGTGAGGAGCACATGGGCAAAATATCAAAGAAAGGTAAAATAACAGTCACAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13209
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056982 Nonsense 243 380 3 6
Genomic Location (Zv9):
Chromosome 13 (position 46754668)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 46050436
GRCz11 13 46187060
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGCACAGCGACAGGATCTTCACTGARCTCATTAGATCCCTTACCAAAAAA[C/T]GAACTGAAGTGAGAGGAGAGATCAGAGCTCAGGAGAAAAGGGAGACTCAR
Long Flanking Sequence:
GAGCCCATTAAAAAGCATTGGATGCAGCTCAGATTGCACTGCACCAGGTCTGCATCCAGACCCCTCTCACTGAAACTCAGATCTAGGTTTTGCACCCCATTGCTTAATAAAAAGGTCCATTACCAGCATTGCTCTCTATAGACACCTAGTGACTGTGCTAAGAAATAGCAGACAAACCAATTTATCCTGAGCCAATGACCTGACCACACATTTGTCTATCAACTATAAATGATCAACCAGAAGTCAAGTCATTTTTTGCTGTTCTCAAAACTTGGATAGGCGACAAGACTTTTGTCAGGTAGCGTATTTATTGCCTGGGCATAAAATAAAATATTTATTTCTTTGTCCGACTTATTCAGAGACAACAGTCACACACATTCAATTTGTAATTTATTAGGCTAATAACCTATGTTACTGTGTCCTGACAGAGCTCTGCACAGGCAGCAGTGGAGCACAGCGACAGGATCTTCACTGAACTCATTAGATCCCTTACCAAAAAA[C/T]GAACTGAAGTGAGAGGAGAGATCAGAGCTCAGGAGAAAAGGGAGACTCAACAGATTATCGGTTACATACAAAAACGGGAACAGGAGATCAGCAATCTTCAGAAGCGGAATGATAAACTGGGGCAGATTTTGTGTACAGAAGATTACATTCATTTCTTCCAGGTATAAAAAAAGTATAAGAGATGCATTCTCTTTTTTTATTAAGTGCTCACTATTGACTCTATGAAGTCTTTTCCTCTCAAATTGCAGAATTACTCCTCTCACTCTACCAAAATACCATATACTTTACCAAAGAAAGTTCATGATGATCTCGTAACATTCAGGGAAGTAGATCAATCTGTCTCTGAGCTGAAAAGAAAACTGGATGAAGTCTGTGAGGAGCACATGGGCAAAATATCAAAGAAAGGTAAAATAACAGTCACAAACTGTTCAGAGAAATACAGTCTAGCTAGTTACAGGTGTCAAACATAGTTACTATAGACCCGCAGCTCTGCACAGTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3855
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056982 Essential Splice Site 297 380 4 6
Genomic Location (Zv9):
Chromosome 13 (position 46754421)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 46050189
GRCz11 13 46186813
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTATTAAGTGCTCACTATTGACTCTATGAAGTCTTTTCCTCTCAAATTGC[A/T]GAATTACTCCTCTCACTCTACCAAAATACCATATACTTTACCAAAGAAAG
Long Flanking Sequence:
GTCATTTTTTGCTGTTCTCAAAACTTGGATAGGCGACAAGACTTTTGTCAGGTAGCGTATTTATTGCCTGGGCATAAAATAAAATATTTATTTCTTTGTCCGACTTATTCAGAGACAACAGTCACACACATTCAATTTGTAATTTATTAGGCTAATAACCTATGTTACTGTGTCCTGACAGAGCTCTGCACAGGCAGCAGTGGAGCACAGCGACAGGATCTTCACTGAACTCATTAGATCCCTTACCAAAAAACGAACTGAAGTGAGAGGAGAGATCAGAGCTCAGGAGAAAAGGGAGACTCAACAGATTATCGGTTACATACAAAAACGGGAACAGGAGATCAGCAATCTTCAGAAGCGGAATGATAAACTGGGGCAGATTTTGTGTACAGAAGATTACATTCATTTCTTCCAGGTATAAAAAAAGTATAAGAGATGCATTCTCTTTTTTTATTAAGTGCTCACTATTGACTCTATGAAGTCTTTTCCTCTCAAATTGC[A/T]GAATTACTCCTCTCACTCTACCAAAATACCATATACTTTACCAAAGAAAGTTCATGATGATCTCGTAACATTCAGGGAAGTAGATCAATCTGTCTCTGAGCTGAAAAGAAAACTGGATGAAGTCTGTGAGGAGCACATGGGCAAAATATCAAAGAAAGGTAAAATAACAGTCACAAACTGTTCAGAGAAATACAGTCTAGCTAGTTACAGGTGTCAAACATAGTTACTATAGACCCGCAGCTCTGCACAGTTTAGTTCTAACTCTGAGGCCCATTTACACTAGTGCATTTTAGTTTTACAACGGCGTTTTAGGGTGCTTTCACACCTACACTTTTGTTTCGGAACGTATCTCGTTTGCCCAGTTAGCGCGGTTCGATTGGCATATGTGAACAGGGCAATCGCACTCTGTTCCGCGCCAAAGTAATCGCTCCGAGATCGCTTGAATGAGGTGGTCTCGGCTCGATTGAAATGAACCCTGGAGCGGATCGATTGCAGTGAGA
Associated Phenotype:
Not determined