Busch Lab

ZMP

LOC100332741

Ensembl ID:
ENSDARG00000076014
Human Orthologue:
ERC1
Human Description:
ELKS/RAB6-interacting/CAST family member 1 [Source:HGNC Symbol;Acc:17072]
Mouse Orthologue:
Erc1
Mouse Description:
ELKS/RAB6-interacting/CAST family member 1 Gene [Source:MGI Symbol;Acc:MGI:2151013]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa26217 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa26217
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086716 Nonsense 357 424 2 3
Genomic Location (Zv9):
Chromosome 4 (position 7439307)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 8251399
GRCz11 4 8260028
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACTGGCCGATGCTGAAATGCACATCCACCATCTGGAGAGTTTGCTGGAT[C/T]AGAGGGACAAAGAGATGGGGCTGCTGAGAGAGGTAAGAGGAAACCAGCAC
Associated Phenotype:
Not determined