Busch Lab

ZMP

LOC562087

Ensembl ID:
ENSDARG00000076011
Human Orthologue:
PPM1K
Human Description:
protein phosphatase, Mg2+/Mn2+ dependent, 1K [Source:HGNC Symbol;Acc:25415]
Mouse Orthologue:
Ppm1k
Mouse Description:
protein phosphatase 1K (PP2C domain containing) Gene [Source:MGI Symbol;Acc:MGI:2442111]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa24411 Essential Splice Site Available for shipment Available now
sa37789 Nonsense Mutation detected in F1 DNA Not yet available
sa18150 Nonsense Available for shipment Available now
sa1186 Nonsense Confirmed mutation in F2 line Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4256
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113757 Nonsense 31 358 1 6
Genomic Location (Zv9):
Chromosome 23 (position 43982518)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 44012685
GRCz11 23 43814203
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTCGATGCGTGCATCCTGCCAGGWGTGTGCGTGTGCCYGGAGTCCGCTG[G/A]CACACCACTCGTTTGGACATGGACGGCAGCGGCCGTCCAGCCACCTGGGA
Long Flanking Sequence:
AAGTCATCCAGGTACTTCTCTCATATTGATTTCCAAATTCTATGAATTCGGACATACTACTCGGTTCGCATACTGTTTTTAGCGTAGTATATAGTATGGAAGTTTGCGATTTTGGGCGCAGCTCAACATTTTATTCGCAGTAGGGACTGTAGCAGACACCGCTAGCTATTCTAACTTTTGTTTTATTCACATAGATGTTCCATACTGAAACAGACGTATACGAGAATGTTTTCTTCTGCTTATTAAATCACCCGTTCAATTGTTATTTTTGATTTATTGATGTGCACATGCCCAGTAGCTGCAGATGTATGCCTTGTTGGTTTACTGACTTGTAACCACTATGAAACCGACACTGCTAGCTATGCTAATTTTAGTTTTATTCTTGTAGACGTCCCATCTGAAGTGTTGATGTCCGTGTCTGCCGTCTGCTTTTCTCGGCTGCTGAGATGCGCTCGATGCGTGCATCCTGCCAGGTGTGTGCGTGTGCCCGGAGTCCGCTG[G/A]CACACCACTCGTTTGGACATGGACGGCAGCGGCCGTCCAGCCACCTGGGACTCCTTCGGGATTTGGGATAACCGGATAGAGGAACCCATCCTGCTGCCACCCAGCATCCGCTACGGAACCCCGATCCCGCACATCAGTGTGTCCAGGGTGGGCTGCGCGACTCTGATCGGCCGCCGGCGGGAAAACGAGGACCGTTTCCAAGTGAGCGAGCTGACGCAAAACGTGCTGTACTTCGCCCTGTTTGACGGACACGGGGGCGCACACGCCGCAGATTACTGCCACAAACACATGGAGCAGAACATCAGGTACAGCACTGAAAAATCTGTCAAAACATACATGAGTGCTCATTTTCTGCTTTTGGAAACTAATAACAAAAATGTTAACAATGTTAATTTAATACTGTTATTCTTTTCACACACTGTTATTCATGATTTTGGTTGAGCAATTAATCTGTGCAAGTTAATCCACTGAAGAAATGTTTGCGTTTGGATTGGCAGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24411
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113757 Essential Splice Site 222 358 3 6
Genomic Location (Zv9):
Chromosome 23 (position 43984816)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 44014983
GRCz11 23 43816501
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCAAACTCACAGACGATCACACTCCGGAGAGAAAAGACGAGAAACACAGG[T/C]ACACACACACTTACACATACACAGATACTTGCATAGTTGTACTGACACTA
Long Flanking Sequence:
TGTGTGTTTTATTCGACTGCACAGAGCAGCATTATAACGGAAACCTAAAATGTATTTAGTGTGATAAAACAGTGCTGTACTGTGGTATAATAAAAGCTCCTCTACTTTCGTATTTTGTATACAATTTTCTTAGCCACGCCACTCTTACCATTACTTTGCTATGAGGGAATGATGCAGAAAATAAAGCCCCGCCCCCTACTCAATATTCAGCTTTCATTGGAAGAACATCGACATAGTGAAATATAAGTCTCAGCAATTTCCACATAACACAGACTTTATTTAAAGTAAACAACATAATGAAATGACTTTAAATTATGCGTGTTTGCTGTTCAGCCTCCCTCATGATGGTGGGCACGACGGCGACAGTGGCTCTGCTTCGGGACGGCATTGAGCTGGTGGTCGGCAGCGTTGGAGACAGTCGAGCTCTGCTGTGTAGGAAAGGAAAATCACGCAAACTCACAGACGATCACACTCCGGAGAGAAAAGACGAGAAACACAGG[T/C]ACACACACACTTACACATACACAGATACTTGCATAGTTGTACTGACACTACACGACCTGACAAGCAGCAAAGTTGCTTCTAGTTGATGTGTAAAAGTGTCAGAAGGTGGATTTTTCTGTTGTATCATCTGTTCTGCATCCCGATCATTACCAATACTGCAGAAGACCTACTGGAACCCACATGGAGCCAAGATCCTCACAGAAATCAGTCAAGTTTGGTGAAGGAAAAATCATGGTTTGGGATTACATTCAGTATGGGGGTGTGCGAGAGATCTGCAACATTAACAGCCTGAGGTATCAAGACATCTGTGCTGCCCATTACATTACAAACCACAGGAGAGGGACAATTCTCCAGCAGGATAGCGCTCCTTCTCATACTTCAGCCTCCACATCAAAGCTCCTGAAAGCAAAGAAGGTGAAGCTGCTCTAGGATTGGCCAGCCCAGTCACCAGATACGAACATTATTGAGCATGTCTGGGGTAAGATGAAGGAGGAGGCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37789
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113757 Nonsense 255 358 4 6
Genomic Location (Zv9):
Chromosome 23 (position 43991653)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 44021820
GRCz11 23 43823338
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAACGTTAACGGCCGCTTGGCAATGACCCGCAGCATCGGAGACTTTGACT[T/A]GAAAAAAAGTGGCGTGATCGCTGAACCAGAGATCACACGGACTCTAGTAT
Long Flanking Sequence:
ATCTTTGGCTCTGGATGGCCACAGTCCTCCACTGTACCTTGGTCCCGCATTTATTTCAAAGGAGCGCTACCCTGTAGCAAGATGGAGGCGCTATTGACGCATTCCGTCCAATAGACTAAAATAGGCCAGGCGACATCTAATGTATATATCTATGACTGAATACTAGTATCCTGAAGAATATCTAATCAAATATTATGTGCTGTCATGATGGCAAATATAAAATAAATCAGTTATTAGAGATGAGTTATTAAAACTATTATGTTTAGAAATGTGTTGGAAAAAAATCTGCTCTCTGTTAAACAGAAATTGGGGAAAAATATACAGGGGGGGGCTAATAATTCTGACCTCAATGGTATATATAACTATTATTATTAAATAATTTAACTAATATGTCTTTTGTAGGATCCGTCAGAGTGGTGGGTTCGTGACCTGGAACAGCGTCGGCCAGGCTAACGTTAACGGCCGCTTGGCAATGACCCGCAGCATCGGAGACTTTGACT[T/A]GAAAAAAAGTGGCGTGATCGCTGAACCAGAGATCACACGGACTCTAGTATGTGCTTTTCACATTATTTCATCCCTATGACTTTTAAAATGTATTCCCTCATTGTTTGACATGAAACCAGGGTGTGGATTACTGGGTGTATGGGTATTTAAGTCCTTTAAAATTGAGAAATAGCTTGCTGTTATTCATTCATTTTCCTTCAGGTTAGTCCCTTTATTCACAGCGGAATGACTCACTAATTTATCCAGCACATGTTTTACACAGCGGATGCTCTTCCAGCTGCAACCCAGTACAGGGAAACACCCATACACACTCATTCACACACATACACTACAGCCAATTAAGTTTATTCAATTCACCTATAGCGCATGTGTTTGGACTGTGGGGGACCCAGCCAGGGCTCAAACCAGTGACCTTCTTGCTGTGAGGCCACAGTGCTAACCACTGAGCCACTGTGTTCTCCCAGTTTGCTGTTAACTTTGTCTTAAATAATAATTTAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18150
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113757 Nonsense 256 358 4 6
Genomic Location (Zv9):
Chromosome 23 (position 43991655)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 44021822
GRCz11 23 43823340
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACGTTAACGGCCGCTTGGCAATGACCCGCAGCATCGGAGACTTTGACTTG[A/T]AAAAAAGTGGCGTGATCGCTGAACCAGAGATCACACRGACTCTAGTATGT
Long Flanking Sequence:
CTTTGGCTCTGGATGGCCACAGTCCTCCACTGTACCTTGGTCCCGCATTTATTTCAAAGGAGCGCTACCCTGTAGCAAGATGGAGGCGCTATTGACGCATTCCGTCCAATAGACTAAAATAGGCCAGGCGACATCTAATGTATATATCTATGACTGAATACTAGTATCCTGAAGAATATCTAATCAAATATTATGTGCTGTCATGATGGCAAATATAAAATAAATCAGTTATTAGAGATGAGTTATTAAAACTATTATGTTTAGAAATGTGTTGGAAAAAAATCTGCTCTCTGTTAAACAGAAATTGGGGAAAAATATACAGGGGGGGGCTAATAATTCTGACCTCAATGGTATATATAACTATTATTATTAAATAATTTAACTAATATGTCTTTTGTAGGATCCGTCAGAGTGGTGGGTTCGTGACCTGGAACAGCGTCGGCCAGGCTAACGTTAACGGCCGCTTGGCAATGACCCGCAGCATCGGAGACTTTGACTTG[A/T]AAAAAAGTGGCGTGATCGCTGAACCAGAGATCACACGGACTCTAGTATGTGCTTTTCACATTATTTCATCCCTATGACTTTTAAAATGTATTCCCTCATTGTTTGACATGAAACCAGGGTGTGGATTACTGGGTGTATGGGTATTTAAGTCCTTTAAAATTGAGAAATAGCTTGCTGTTATTCATTCATTTTCCTTCAGGTTAGTCCCTTTATTCACAGCGGAATGACTCACTAATTTATCCAGCACATGTTTTACACAGCGGATGCTCTTCCAGCTGCAACCCAGTACAGGGAAACACCCATACACACTCATTCACACACATACACTACAGCCAATTAAGTTTATTCAATTCACCTATAGCGCATGTGTTTGGACTGTGGGGGACCCAGCCAGGGCTCAAACCAGTGACCTTCTTGCTGTGAGGCCACAGTGCTAACCACTGAGCCACTGTGTTCTCCCAGTTTGCTGTTAACTTTGTCTTAAATAATAATTTAATAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1186
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113757 Nonsense 319 358 6 6
Genomic Location (Zv9):
Chromosome 23 (position 43996779)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 44026946
GRCz11 23 43828464
KASP Assay ID:
554-1095.1 (used for ordering genotyping assays)
KASP Sequence:
CCTGATAATTCTGATAGCACAAGTGTTTGTGTCGTCCAGGCTCTTCAGTA[C/A]GGCTCTGAGGACAACAGCACAGTGATCGTGGTCCCGTTTGGAGCCTGGGG
Long Flanking Sequence:
TGTTTCTATAGAAAAGTAATACTATTACGTAACGTATGTTAATTATAAGGAGTTATACCCAACACTGGTCATGATTATTAAATAACCATCCATAATTATGGTTGTATTTTATTGTTTCTTTTGATACATGACAGGATATAGCAAAAACATACTTCAGGTATAAACAGTTGAATTATTCGTCCTCCTGAAGAAAAAATATTATAGGAAATACTGTGAAAAATTCCTTGATTTGTTAAACATCATTTGGGAAGCATTTGAAAAAGAAAAAAAAAATCACAAGAGGATGAATAATTCTGGCTTCAGCTGTATATTACGAGATGAGCAAGTGAAAGAAAGAAAAACAGAGCAACAGTTTTTTGACTGGAGTTTATTGTTATACTCACATGAGATATCACTAAAGATTTTTTTAATTTGAATAAAACCCGAGTCAACTTATTGCCAGACTAATTTCCTGATAATTCTGATAGCACAAGTGTTTGTGTCGTCCAGGCTCTTCAGTA[C/A]GGCTCTGAGGACAACAGCACAGTGATCGTGGTCCCGTTTGGAGCCTGGGGGAAACATCAAAACACAGACTACACACACGACATGAGCCGAAACTTTGCCTCCATAGGCCGCTGGTCTTAACATGAAGACTAACACTCTCCAACTACAGCACTGCCGTTACACTGACAACTGCACTATGAGGAGGAGGAAACATCTGCTTTAAACCAACCTTTACATCTAAAGACAGAAGGTGTGGCGGATTATTTGCTTTATTATTCGTGACCCTGGACGCAAAACCAGACTTATGCTGCATGGATAGATTTGTGGAAGGAGCCAATATATTATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATAATAAAGGGGTTTTTAACCAATACATACGTACACTGAAATTAATGATTAGTTACAATGTGCGTATTGTGTAAATACATGTTTATGCATTGCACTTACAGTGGGAAA
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461