Busch Lab

ZMP

si:ch211-197g15.13

Ensembl ID:
ENSDARG00000076001
ZFIN ID:
ZDB-GENE-091204-194
Description:
LOC798876 protein [Source:UniProtKB/TrEMBL;Acc:A8KB45]
Human Orthologue:
PIP5K1C
Human Description:
phosphatidylinositol-4-phosphate 5-kinase, type I, gamma [Source:HGNC Symbol;Acc:8996]
Mouse Orthologue:
Pip5k1c
Mouse Description:
phosphatidylinositol-4-phosphate 5-kinase, type 1 gamma Gene [Source:MGI Symbol;Acc:MGI:1298224]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa45766 Nonsense Mutation detected in F1 DNA Not yet available
sa24142 Nonsense Available for shipment Available now
sa3152 Nonsense F2 line generated Not yet available

Mutation Details

Allele Name:
sa45766
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060786 Nonsense 308 682 7 18
ENSDART00000105443 Nonsense 269 633 6 17
ENSDART00000111931 None None 274 None 7
Genomic Location (Zv9):
Chromosome 22 (position 17789647)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17540582
GRCz11 22 17565560
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACGGACTCATGCTGGACACAGACACATACAACGCCCTGGTCAAGACCTTA[C/T]AGAGAGACTGTTTGGTAAGTTCTGGACAGGACAAAACATTTGAACCAGAT
Long Flanking Sequence:
CATTTAAGAAAAAATGAAAGGGCTCTTCTTCACCTTAAATCCAAAATTGTATTGTGAGATTAATATTGTGAATCGCATTGCATCGTGAGTCAGGTGAATCGTTACATCCCTGTTCGCAAACCATGTAATCAACAAATACAAGTATAAATCATTTAGCACAGCGTATTTGTTTACATCTGCTAGTCGTTTAATCTTTCAAATGTTTGTCTCCTCAGAACTTGAATCAGAATCCTCGCACCTTATTACCCAAGTTCTTCGGGCTCTACTGCGTACAATCGGGTGGCAAGAACATTCGAATGGTGGTGATGAACAACGTTTTGCCCAGGGTGGTGCGCATGCACCTTAAATACGACTTAAAGGGGTCCACATACAAAAGGCGGGCATCAAAAAAAGAACGGGAAAAGGCAAAACCAACTTTTAAAGACCTTGACTTCATGCAGGAATTACCAGACGGACTCATGCTGGACACAGACACATACAACGCCCTGGTCAAGACCTTA[C/T]AGAGAGACTGTTTGGTAAGTTCTGGACAGGACAAAACATTTGAACCAGATAAATGTTTGTAATGAGTAGGATTTTAAAGATATTTTTGAAGCTGTTCTGCTCAACAAGGCTGCATTAATTTGATCAAAAATACAGTAAAAATGTGAAACATGATTACAGTTTAAAATAAGTGCTTCCCTATTTAATGTAGTTAAAAACTGTCCTTATTCCTGATTTAAAGCTACACTTTCACTATCATTACTTCCGTCTTCAGGTGTCGCATGAATCTTTGGAAATGATTATAATATTATGATCTGCTGTTCAATAAATATTAGTTAATTTCTTGCATTTATACAGCGCTTTTCTAGACAATCAAAGCGCTTTACACAATAACGGGAATCTCCTCATCCACCACCAGTGTGCAGCATCCAACTGGATGACACAACAGCAGCCAAATTGCGCCAGACCGTGCACCCCACAACAGCTAATTGATGGAGAGAAGACAGAGTGATAAAGCCAAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4997
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060786 Nonsense 633 682 16 18
ENSDART00000105443 Nonsense 584 633 16 17
ENSDART00000111931 None None 274 None 7
Genomic Location (Zv9):
Chromosome 22 (position 17774733)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17525668
GRCz11 22 17550646
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGTCCCAGGATCGTGGTGGAGTCTGACGGCGGCAGTCAGGCCTCAGGCTG[T/A]ACAAGTAGAGCCTCGGTGGACGAGGAGGATGACGTGCCAATCACAGACAT
Long Flanking Sequence:
AATCTGCTGGTTTGTGGTGTGCGGTCGGCCATCACATCATTTAGTTGGAGACTGCACACTGGTGGGGAATGAGAATCCCCGCAATGTGTAAAGCGCTTTTAGTATCTAGAAAAGCTCTATATAAGTGTAAGGAATTATAATTATGTCAATTTTATAATCCAGACTAAAAACAACTAACTAAAACAAAAGCCAAATATTAATGAACACTATAATATATAATTAATGGTACAATTACACTTCCAAAGAGACTCATAAAATTTTGAGTATGTTTTTACCAAAACAAAGAAGAAAAGATAAAATTAGTTCCATTTCAACTTCATTTGACAGTTTTGCCAGATGAACAGGCAACATTATACTCCCTGATGATCTCAAAACAATGTTTCTGTTTGTCGTGTGTCCAGTGAAGCTGCAGAGACTATTCCAGAAGCCTCGTCCTCCTCCGTCCCGGCGAGTCCCAGGATCGTGGTGGAGTCTGACGGCGGCAGTCAGGCCTCAGGCTG[T/A]ACAAGTAGAGCCTCGGTGGACGAGGAGGATGACGTGCCAATCACAGACATTTATTTTGTAAGCTGATCAATTTAACCAGACATATCTTCAAACATGCAAACATTTAATTTTTCATTTTAAAAGTAAGTTTCCTTGAGAGCTTGGACATGAAATAAATATAAATATATAGAATCACTCACACTTTGCAATAAGTTGCTTAATGCATTCACAAACATGAACTAATAATGAACAATACTTGTACAGCCTAAATGAATCACAGTTCAACATTTACTAATGCGTTATTAAAAACTGAATTTTTATTTGTCATCAGTACACTGTTAGCTAACATGAACTAACAGTGAACAACTCTATTTTCATTAACTAACATGAAGAAATACTGTAATCAATATATTGTTTATTGTTTGTTCGTGTTAGTAAGTGCACAACATAACTAATACAACCTAAGTTACCTACGTTTCTTCTAACATAGTAAATTTACTTAAAGTACAGTTAAATGTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24142
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060786 Nonsense 636 682 16 18
ENSDART00000105443 Nonsense 587 633 16 17
ENSDART00000111931 None None 274 None 7
Genomic Location (Zv9):
Chromosome 22 (position 17774726)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17525661
GRCz11 22 17550639
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGATCGTGGTGGAGTCTGACGGCGGCAGTCAGGCCTCAGGCTGTACAAGT[A/T]GAGCCTCGGTGGACGAGGAGGATGACGTGCCAATCACAGACATTTATTTT
Long Flanking Sequence:
TGGTTTGTGGTGTGCGGTCGGCCATCACATCATTTAGTTGGAGACTGCACACTGGTGGGGAATGAGAATCCCCGCAATGTGTAAAGCGCTTTTAGTATCTAGAAAAGCTCTATATAAGTGTAAGGAATTATAATTATGTCAATTTTATAATCCAGACTAAAAACAACTAACTAAAACAAAAGCCAAATATTAATGAACACTATAATATATAATTAATGGTACAATTACACTTCCAAAGAGACTCATAAAATTTTGAGTATGTTTTTACCAAAACAAAGAAGAAAAGATAAAATTAGTTCCATTTCAACTTCATTTGACAGTTTTGCCAGATGAACAGGCAACATTATACTCCCTGATGATCTCAAAACAATGTTTCTGTTTGTCGTGTGTCCAGTGAAGCTGCAGAGACTATTCCAGAAGCCTCGTCCTCCTCCGTCCCGGCGAGTCCCAGGATCGTGGTGGAGTCTGACGGCGGCAGTCAGGCCTCAGGCTGTACAAGT[A/T]GAGCCTCGGTGGACGAGGAGGATGACGTGCCAATCACAGACATTTATTTTGTAAGCTGATCAATTTAACCAGACATATCTTCAAACATGCAAACATTTAATTTTTCATTTTAAAAGTAAGTTTCCTTGAGAGCTTGGACATGAAATAAATATAAATATATAGAATCACTCACACTTTGCAATAAGTTGCTTAATGCATTCACAAACATGAACTAATAATGAACAATACTTGTACAGCCTAAATGAATCACAGTTCAACATTTACTAATGCGTTATTAAAAACTGAATTTTTATTTGTCATCAGTACACTGTTAGCTAACATGAACTAACAGTGAACAACTCTATTTTCATTAACTAACATGAAGAAATACTGTAATCAATATATTGTTTATTGTTTGTTCGTGTTAGTAAGTGCACAACATAACTAATACAACCTAAGTTACCTACGTTTCTTCTAACATAGTAAATTTACTTAAAGTACAGTTAAATGTAAGCTTCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3152
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060786 Nonsense 675 682 17 18
ENSDART00000105443 Nonsense 626 633 17 17
ENSDART00000111931 None None 274 None 7
Genomic Location (Zv9):
Chromosome 22 (position 17768162)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17519097
GRCz11 22 17544075
KASP Assay ID:
554-2472.1 (used for ordering genotyping assays)
KASP Sequence:
GCTGGGTTTATTCTCCTCTGCATTTCAGCTCAGGGCCTAAAACCCTGCCC[G/T]AGGATGAAGGGGAAAGTGAAACAGTAAGTGTGCATTGTGTCATTSATCGT
Long Flanking Sequence:
TAATGTCCATCTCTAGCCACTGTGTTTTTAAAGGTTTTGTTTACATGGCAGTGGTGCACATGCAAATTTCGCTTTTAAATGTTTGAATTTTTTTACACGCAATAAACTAATTGCACTCTATTCCGTATCCCAGGCCAGTAGATGGCGACTTCACTTCGTAAATAAACACCAATAATCTGTGCACAGATGTAGTCGTTCTAGTATGTGAAGGTGACTATAGACTGAAGGCTTTTACATTGGTTTTTTTATATAGTTAAAATAAAGATGTTTTAGTAGTTTAGCTTTCAAATAACGTGTACTTCAAAACCCATTTCCATTTTCCCGACACCTTGAAATGTTCAAATCGGTGACACTTATATTCCTCTCTGCCGCTCTTGTTTTCCTGTCTTTCCTCCTCTCTGGCTCCCTCTGCTGTACTGCTGGTATAACTGCAGCCTCCAGAAGACAAAAGCTGGGTTTATTCTCCTCTGCATTTCAGCTCAGGGCCTAAAACCCTGCCC[G/T]AGGATGAAGGGGAAAGTGAAACAGTAAGTGTGCATTGTGTCATTGATCGTCTTCAGTTCACAGTCCTTGATGTTGATGGTAGCAACCCTTTTTACCATGTCTCGACAGTAATCAGACCTCAGGAGAGAAGGGCAGCTAAAGGTTTGGACTCTTCAGATGAATCATGTCGGATGGACGCTGCTGTCAGATGTTTCCGCAACTGCTTCATCTTCATCGTCCTGTCATCTATTCCACAAACAGAACCAAGCGAGTGGTAATGCCATTGTATAGAGGTATTTAAAAGTAATAATGAAAGTTTTTGTTTGATTGTGTTAAAAGTTCTGTTCTTTTATTTTATTAAGTACTGTGAAATGTGTTCATCCAAGTAAGTTCTGGGACTCAAGCCTCTCCTCATTGGCATTTTTTTTATTTTTTTTATTTTGGAGGTAGGCTGAGAGTTTTGTTGACAAAATAAATGTATTTGTATTTATTTTAGTTTGGTTATTGGCATCATTACGAAA
Associated Phenotype:
Not determined