Busch Lab

ZMP

arpc2

Ensembl ID:
ENSDARG00000075989
ZFIN ID:
ZDB-GENE-030131-5276
Description:
actin-related protein 2/3 complex subunit 2 [Source:RefSeq peptide;Acc:NP_997864]
Human Orthologue:
ARPC2
Human Description:
actin related protein 2/3 complex, subunit 2, 34kDa [Source:HGNC Symbol;Acc:705]
Mouse Orthologue:
Arpc2
Mouse Description:
actin related protein 2/3 complex, subunit 2 Gene [Source:MGI Symbol;Acc:MGI:1923959]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa160 Missense Confirmed mutation in F2 line Not yet available
sa41549 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa160
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099803 Missense 151 299 5 10
Genomic Location (Zv9):
Chromosome 9 (position 49048083)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 48363153
GRCz11 9 48060548
KASP Assay ID:
554-0020.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGGTCGCGATGGCGAGAAAAGAGCCGTTGTTCATTACAGGGACGACGAGT[C/T]GATGTAAGATACTGAGAGTTCCTTCAAACTGTTTTCATAATCAGCTAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41549
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099803 Essential Splice Site 293 299 9 10
Genomic Location (Zv9):
Chromosome 9 (position 49032456)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 48347526
GRCz11 9 48044921
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGAACCGTGCTCGCCCGGACGCTGAGAAGAAAGAGATGAAAACTATTTC[G/A]TAAGTGCCGTTTTCACAATCATTAGCATTTCACACCTTCGTATAAAACCA
Associated Phenotype:
Not determined