Busch Lab

ZMP

slc45a3

Ensembl ID:
ENSDARG00000075975
ZFIN ID:
ZDB-GENE-070509-3
Description:
solute carrier family 45, member 3 [Source:RefSeq peptide;Acc:NP_001091665]
Human Orthologue:
SLC45A3
Human Description:
solute carrier family 45, member 3 [Source:HGNC Symbol;Acc:8642]
Mouse Orthologue:
Slc45a3
Mouse Description:
solute carrier family 45, member 3 Gene [Source:MGI Symbol;Acc:MGI:1922082]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa35148 Nonsense Mutation detected in F1 DNA Not yet available
sa15619 Nonsense Available for shipment Available now
sa12568 Nonsense Available for shipment Available now
sa10619 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35148
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113894 Nonsense 28 537 3 6
Genomic Location (Zv9):
Chromosome 11 (position 39760233)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 38258489
GRCz11 11 38525694
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATGCATTAACATGTGGCTTGGAGGTTTGTTTGGCTGCTGGGACCATCTA[C/A]ATCCCACCTCTGCTGCTGGAAGCTGGGGTGGAGGAACGCTTCATGACCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15619
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113894 Nonsense 191 537 4 6
Genomic Location (Zv9):
Chromosome 11 (position 39756718)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 38254974
GRCz11 11 38522179
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACCACTTCAGACACTGCTGTCTACCTGGGTGGACAGGAGGCYTTCATCTA[C/A]ACTGTTYTGACATTMATTTTTTTGGCCTGTTTGATAGGTACGWGGTTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12568
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113894 Nonsense 191 537 4 6
Genomic Location (Zv9):
Chromosome 11 (position 39756718)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 38254974
GRCz11 11 38522179
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACCACTTCAGACACTGCTGTCTACCTGGGTGGACAGGAGGCYTTCATCTA[C/A]ACTGTTYTGACATTMATTTTTTTGGCCTGTTTGATAGGTACGWGGTTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10619
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113894 Nonsense 269 537 4 6
Genomic Location (Zv9):
Chromosome 11 (position 39756485)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 38254741
GRCz11 11 38521946
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCCCAGACTSTATAGGCTGTGYAGTCGGATGCCAAAAGTCATGGCAAGGT[T/A]GTTTGTGGCGGAGTTGWGCAGCTGGATGGCTCTCATGTCTTTTCTCCTCT
Associated Phenotype:
Not determined