Busch Lab

ZMP

ENSDARG00000075964

Ensembl ID:
ENSDARG00000075964
Human Orthologues:
ARHGEF40, PLEKHG4
Human Descriptions:
Rho guanine nucleotide exchange factor (GEF) 40 [Source:HGNC Symbol;Acc:25516]
pleckstrin homology domain containing, family G (with RhoGef domain) member 4 [Source:HGNC Symbol;Ac
Mouse Orthologues:
E130112L23Rik, Plekhg4
Mouse Descriptions:
RIKEN cDNA E130112L23 gene Gene [Source:MGI Symbol;Acc:MGI:2685515]
pleckstrin homology domain containing, family G (with RhoGef domain) member 4 Gene [Source:MGI Symbo

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa45284 Nonsense Mutation detected in F1 DNA Not yet available
sa7074 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa21000 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa45284
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108473 Nonsense 875 2484 1 22
Genomic Location (Zv9):
Chromosome 7 (position 36179537)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 34453380
GRCz11 7 34724857
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAATGTAATTAATACATCACAGCCAGAGACTGAAATGTTATCTTGTGTTT[T/A]GGAAAGGGAGAACTCAGAACAGGTTTCTCCAGCTTATATTGAACTCATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7074
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108473 Essential Splice Site 1372 2484 4 22
Genomic Location (Zv9):
Chromosome 7 (position 36185731)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 34459574
GRCz11 7 34731051
KASP Assay ID:
554-4819.1 (used for ordering genotyping assays)
KASP Sequence:
CAGGTGTTCACCTGTTCCCGCCCTTTTCAAAGCCTTYAACATCCTCCAGG[T/C]AAGAACACCCTGAMAGTATGATTTGYAATAACAAACACGCATGCAGTGTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26990
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108473 Essential Splice Site 1401 2484 5 22
Genomic Location (Zv9):
Chromosome 7 (position 36191029)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 34464872
GRCz11 7 34736349
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCCGACAGAGATCTGGCTCTACGCATGGAGAAAACCTCTTCTATACAGG[T/A]AATGCACAATTACTACTGATTACCTACCTGTAACTTAGCATGGCGTTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21000
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108473 Nonsense 1430 2484 6 22
Genomic Location (Zv9):
Chromosome 7 (position 36191711)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 34465554
GRCz11 7 34737031
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATGTGGACGTTTCTCAGCTTCCCACTGAGTTTGAAGGCACTTTCCCTTA[T/G]GCACACAGCAGCTGGGTCAGCTTTAGAATGGTGAGAAAATCACAATCTTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2370
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108473 Essential Splice Site 2224 2484 16 22
Genomic Location (Zv9):
Chromosome 7 (position 36225902)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 34499745
GRCz11 7 34771222
KASP Assay ID:
554-3011.1 (used for ordering genotyping assays)
KASP Sequence:
GCGCATCGAGGGTGGACTAGATGTTTACATATACAAGCATTCTTTTAAGG[T/C]GAGCACCTAAAGGACATGTGTTCACAGAAACAACAAGTGCGCTTGGTTGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2344
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108473 Essential Splice Site 2406 2484 19 22
Genomic Location (Zv9):
Chromosome 7 (position 36228528)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 34502371
GRCz11 7 34773848
KASP Assay ID:
554-2461.1 (used for ordering genotyping assays)
KASP Sequence:
CATCGAGGAGGACGAGCTGGAGCATGAGACCAGTAGTCAGCCCTCTATGA[G/T]TAAGTGTCCTAACATGTGGATTGGAACATGCATGTTCTCAGATGTGACAC
Associated Phenotype:
Not determined