Busch Lab

ZMP

zgc:171630

Ensembl ID:
ENSDARG00000075954
ZFIN ID:
ZDB-GENE-080219-21
Description:
serine (or cysteine) proteinase inhibitor, clade H, member 1 [Source:RefSeq peptide;Acc:NP_00110384
Human Orthologue:
SERPINH1
Human Description:
serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1)
Mouse Orthologue:
Serpinh1
Mouse Description:
serine (or cysteine) peptidase inhibitor, clade H, member 1 Gene [Source:MGI Symbol;Acc:MGI:88283]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa41715 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa41715
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109752 Essential Splice Site 193 403 2 5
Genomic Location (Zv9):
Chromosome 10 (position 39882303)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 38572274
GRCz11 10 38516032
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGGAGAAGACAGATGGAGCCATGATCATCAATGCCATGTTTTATAAACG[T/G]AAGTGTTGATTAAAGTTTGAGTGAAAGGCAGTTGGTAGATTCGTTAGAAA
Associated Phenotype:
Not determined