Busch Lab

ZMP

si:ch211-69m14.1

Ensembl ID:
ENSDARG00000075942
ZFIN ID:
ZDB-GENE-050419-226
Description:
Novel FERM domain containing protein [Source:UniProtKB/TrEMBL;Acc:A8DZC9]
Human Orthologue:
FRMD5
Human Description:
FERM domain containing 5 [Source:HGNC Symbol;Acc:28214]
Mouse Orthologue:
Frmd5
Mouse Description:
FERM domain containing 5 Gene [Source:MGI Symbol;Acc:MGI:2442557]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa23313 Nonsense Available for shipment Available now
sa10808 Nonsense Available for shipment Available now
sa19205 Nonsense Mutation detected in F1 DNA Not yet available
sa13053 Essential Splice Site Available for shipment Available now
sa36659 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa7447 Missense Mutation detected in F1 DNA Not yet available
sa23312 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23313
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113280 Nonsense 79 540 4 14
ENSDART00000135133 Nonsense 77 179 4 6
Genomic Location (Zv9):
Chromosome 18 (position 26437262)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 26510517
GRCz11 18 26492895
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATATGTTTACTCTGCTTTATGTTTTGCCTTTGTGTGCTGTTTTCAGGTA[T/A]CTCGTCTTCCTGCAGATTAAGAGAGATTTGTATCATGGTCGTCTCCTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10808
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113280 Nonsense 164 540 6 14
ENSDART00000135133 Nonsense 162 179 6 6
ENSDART00000113280 Nonsense 164 540 6 14
ENSDART00000135133 Nonsense 162 179 6 6
Genomic Location (Zv9):
Chromosome 18 (position 26426794)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 26500049
GRCz11 18 26482427
KASP Assay ID:
2261-2262.1 (used for ordering genotyping assays)
KASP Sequence:
CTTAMTGTTTTGCAGAGGTCAAACCCCAGAGACTTCTGAGCTGAAGTTCT[T/A]GCAGAAAGCACAAATGCTTGAAACATACGGTGTGGATCCTCATCCGTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19205
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113280 Nonsense 164 540 6 14
ENSDART00000135133 Nonsense 162 179 6 6
ENSDART00000113280 Nonsense 164 540 6 14
ENSDART00000135133 Nonsense 162 179 6 6
Genomic Location (Zv9):
Chromosome 18 (position 26426794)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 26500049
GRCz11 18 26482427
KASP Assay ID:
2261-2262.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTAATGTTTTGCAGAGGTCAAACCCCAGAGACTTCTGAGCTGAAGTTCT[T/A]GCAGAAAGCACAAATGCTTGAAACATACGGTGTGGATCCTCATCCGTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13053
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113280 Essential Splice Site 233 540 9 14
ENSDART00000135133 None None 179 None 6
Genomic Location (Zv9):
Chromosome 18 (position 26421903)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 26495249
GRCz11 18 26478897
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCAATGACARWSCTGTATCAGTGCACCTTTAATAATSGTTTRTTATGCAC[A/C]GGACAAAAAGATCATCTTGACATACTTTGCACCCACCCCAGAGGCCTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36659
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113280 Essential Splice Site 343 540 13 14
ENSDART00000135133 None None 179 None 6
Genomic Location (Zv9):
Chromosome 18 (position 26416331)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 26489677
GRCz11 18 26474157
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGTGTCCCTCGCACCCGCCGGAGAGCGGTACACATCTCCATCATGGAAG[G/A]TGAGAGTCCAGTTTTAAGCACGAGTTCAGCTGGAAGCATAGGCACAGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7447
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113280 Missense 501 540 14 14
ENSDART00000135133 None None 179 None 6
Genomic Location (Zv9):
Chromosome 18 (position 26402733)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 26476079
GRCz11 18 26460566
KASP Assay ID:
554-4329.1 (used for ordering genotyping assays)
KASP Sequence:
TCTTGCTCCTCCTCCTCATCGTYCTCACCGAGTCCGATCTTGACATTGCA[T/A]TTTTACGTGATATCCGCCAGACCCCCGAGTTTGAGCAGTTCCATTACGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23312
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113280 Nonsense 525 540 14 14
ENSDART00000135133 None None 179 None 6
Genomic Location (Zv9):
Chromosome 18 (position 26402659)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 26476005
GRCz11 18 26460492
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCGAGTTTGAGCAGTTCCATTACGAATACTTTTGTCCCCTCAGACGGTG[G/A]TTTGCCTGCAAGCTCCGCTGGGTGGGCGGGCTGCTCATTAACAAGTGAAA
Associated Phenotype:
Not determined