Busch Lab

ZMP

adamts22

Ensembl ID:
ENSDARG00000075930
ZFIN ID:
ZDB-GENE-070816-3
Human Orthologue:
ADAMTS2
Human Description:
ADAM metallopeptidase with thrombospondin type 1 motif, 2 [Source:HGNC Symbol;Acc:218]
Mouse Orthologue:
Adamts2
Mouse Description:
a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 2 Gene [

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa32352 Essential Splice Site Available for shipment Available now
sa1626 Nonsense Available for shipment Available now
sa13856 Nonsense Available for shipment Available now
sa29631 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa32352
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114158 Essential Splice Site 158 1295 3 22
ENSDART00000147203 Essential Splice Site 123 1257 2 21

The following transcripts of ENSDARG00000075930 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 31381524)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 32580994
GRCz11 21 32614252
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTACCTGTTTTTGAAAAAGCCTAATCTCTGCCTCTCCTTCAAACCCTTC[A/G]GGCGGGGATGATCCGCGCAGGTCAGGAGGAGTTTTTTATCGAGCCACTGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29632
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114158 Essential Splice Site 359 1295 6 22
ENSDART00000147203 Essential Splice Site 324 1257 5 21

The following transcripts of ENSDARG00000075930 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 31330394)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 32529864
GRCz11 21 32563122
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCATGCCATTTTTCTCACCAGACAAGAATTTGGGCCCACCGGCATGCAGG[G/T]TAATCCATTTTATAAACATGCATGATAATGTAACAAACCAATTAAAAGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1626
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114158 Nonsense 592 1295 12 22
ENSDART00000147203 Nonsense 557 1257 11 21

The following transcripts of ENSDARG00000075930 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 31316423)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 32515893
GRCz11 21 32549151
KASP Assay ID:
554-1567.1 (used for ordering genotyping assays)
KASP Sequence:
GCCAACGGAGGGCGCACTTGTTATGGAAACAACTATGAGTTCCAGTTATG[T/A]AACACGGAGGAGTGCGCAGAAGCCCTGGTGGACTTCAGAGAGGAGCAGTG
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa13856
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114158 Nonsense 676 1295 13 22
ENSDART00000147203 Nonsense 641 1257 12 21

The following transcripts of ENSDARG00000075930 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 31303732)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 32503202
GRCz11 21 32536460
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACTCGCTGTTCCTACAAAGACCCCTACAGCGTGTGTGTKCGTGGAGAGTG[T/A]GAGGTAAAGGTTATTCAAACACACCCATCCCTCCAGTTCATCCTCCAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29631
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114158 Essential Splice Site 1035 1295 21 22
ENSDART00000147203 Essential Splice Site 997 1257 20 21

The following transcripts of ENSDARG00000075930 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 31287804)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 32487274
GRCz11 21 32520532
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGGCTCTCCAGAGCAGACCCAGAGTTCCCGGCACCAAAGATCTCCTCAA[G/A]TAAACGTCCCGTTTCCAGTCATCAGCCTGCCGTGTGCTGCATGGCCGCTC
Associated Phenotype:
Not determined