Busch Lab

ZMP

IGFN1 (2 of 3)

Ensembl ID:
ENSDARG00000075926
Description:
immunoglobulin-like and fibronectin type III domain containing 1 [Source:HGNC Symbol;Acc:24607]
Human Orthologue:
IGFN1
Human Description:
immunoglobulin-like and fibronectin type III domain containing 1 [Source:HGNC Symbol;Acc:24607]
Mouse Orthologue:
Igfn1
Mouse Description:
immunoglobulin-like and fibronectin type III domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:304

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa44643 Nonsense Mutation detected in F1 DNA Not yet available
sa13347 Nonsense Available for shipment Available now
sa33955 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa44643
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114607 Nonsense 249 1260 5 18
Genomic Location (Zv9):
Chromosome 6 (position 46695512)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 46756446
GRCz11 6 46758328
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAGGGAGTCTATTCGGCTATTGCTGGTCTCAGATCAAGCCAGGGGACTT[T/A]GGATGTGGAAGGTAAGCTTTTTTGGTTTATTTATTTTTTTAAGTACTGTG
Long Flanking Sequence:
TGCTGACTTTTTAGTTAAATCAAATTAACTCTTTGAGTCAACTTACATCAGTAAATCTGACTAAAAAATGAATTTAATTAAATAATATAGTTGAAACCTGATAAAAATATTTGTTGCGTTGACTTGTTGTCATGAAATGTTTTACAGTGTATCAATCACTGGTTGATGAGGTATTTGTGCTTGATATTTGACTCAAACTCAATTCTTTTGATAGACTGTTGAATTGTTTTTACCTTCAGTGCCTGACGTGGAGTTTAGCAGGACTCTCAAAGACACGAAAGTGGCAGAAGGGCAGGATGCAGTGTTTGAGTGTGCCTTATTGGACCCTGTCCCACAAATCACCTGGTGCGTCAATGATGTCTCTGTAGAGAATGGAGATAAATATGTTATCACAGTGTCGGAAGACCAGCAAGTGCACAAACTAGCAGTGAAAAACTGCACAAAAGATGACAAGGGAGTCTATTCGGCTATTGCTGGTCTCAGATCAAGCCAGGGGACTT[T/A]GGATGTGGAAGGTAAGCTTTTTTGGTTTATTTATTTTTTTAAGTACTGTGCCTCTTTGGTGAATTTCACATTTCCCTATAATATACCTTATATTAACAGACAGGCAGCACAGTGGCTCAGTGTCGCCTCACAGCAAGAAGGTCGCAGGTTGGAATGGAGGATTAAATTTTAAGATTAAATTTTTGTGAGGAGTTTGCATGTTCTCCCCACGTTCTCCCCTGTACATGAGTAGGTATTCATAAACGTTTGTCTCTCTTTCATTTTAGTATAAATTTTGTATAAATTCCATACAGAAGGTTTTGTCTGATGTCTTTAACTGTAAAAATAATGCAATGCAGCTAATGAGTTGGAACACTGTGCTACTGTACATCTCTTCATTGCGTTTCCATCCATTGGGTGGCCAGTAAAATTGACACCATCTCTTAACAGTCTTATATTTTAAAAGGGTGATATATTCATTTTCTTTCAGCTTAGTCCCTTATTTATCTGGGGTCGCCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13347
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114607 Nonsense 360 1260 6 18
Genomic Location (Zv9):
Chromosome 6 (position 46692496)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 46753430
GRCz11 6 46755312
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGAAGCTGCCAGGAAGGCTCAARAAGAGCAAGATGAGGCAGCCAAGAGGT[C/A]GCAAGCTGAAAGAGATGAAGCGGCCCGGAGAGCTCAGGCTGAAAGAGATG
Long Flanking Sequence:
CCCCAACCTAACAGTCTACTTATAATCTACTGAGAATTAGTTGGCATGTAGAAGCAATGTAACTTTTATTCAACAAACAGACCCTCAAAATGAAGTGTGACCAAAAAGATTTATTATTAATTTTGCCTGATGACTTTGGTGTATTTTGTAACTGCTACTGTTTCCCGATGATCCTAAAGCCAGTGGTACAAGTGACGCAGATGAACTTGCAAAACATTTAGCTGAGGATAAAGCCAGACTGCAGAGGGAAAAGAATGAAGCAGCTAGGAGGGCACAGGCTGAAAAGGATGAAGCAGCCAGGAGGGCACAGGCAGAGCGAGATGAAGCGGCTAGAAAGGCCAAGAAAGAGCAAGATGATGCCAGGAGAGCCCAAGCTGAAAGAGATGAAGCCGCCAGGAGGGCCAAGGCAGACCAAGATAAAGCCTCCAGGAAGGCAAAGGCTGACCAGGATGAAGCTGCCAGGAAGGCTCAAGAAGAGCAAGATGAGGCAGCCAAGAGGT[C/A]GCAAGCTGAAAGAGATGAAGCGGCCCGGAGAGCTCAGGCTGAAAGAGATGAGGCAGCCAGGAGGGCACATGCCGACCGAGAAGCGGCTGAAAAAAGGGCAGCCATGATGGCAAAGAAAGAAGAACAAAATGGCAGTGGAGGATCTATCCTGGTAGATGTCGATGAAGGTGATGGATCAGAGATGAACAATGGAGGAGATGGAACTAGGAAAGATGGAAAAGGAGATGGTTTAGATGTAGATGGTTCAAGAGGAGATGGATCAAGTGAGAAGCGCACAAAACGTGCAAGAGACAGTGAATTGGTTCCTAACTGCATCACAGGTAGTGATGGTCTCAAACTCACATAATATTAAGTCATGAATTACCCTGTGCTGAGATTGTATAATTTGACACATTTCCTCCAGAACATGGAGTCCACTTTCTGAAAGGCTTGTCAGATGCTGTTGTAAACATTGGAGAATCAGCAGAGTTAGGGTGCAAACTTAGCAGTGAAGATAGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33955
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114607 Nonsense 794 1260 11 18
Genomic Location (Zv9):
Chromosome 6 (position 46688632)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 46749566
GRCz11 6 46751448
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCCCTCCAACACTGTAGGAGGCAGTATCATTGGCTACAATGTGGAAAAA[C/T]GAAAAAAGGGCAGCAATTTTTGGAGTCAAGCAAACCTAAAAGATGAACCA
Long Flanking Sequence:
CCACAAGGACCTGTGGAAATTGTAGAAAGCTCCTTGTCTGCTATCGAGTTTAAATGGAGATCCCCGAAGGATGATGGGGGTTGCCCTGTCACTAATTACAACCTGGAGCGTCAACAGCTGGGACGGAACACCTGGACTAAAATTGGAGACATTCCTGGACAGCCTGTCTACAGAGACACGAACACTGAACGTGGTCGAAAGTACTGCTACAGAATCCGCGCAAAAAACTCAGAGGGCCTCAGTGACATCATGACAACTAATGACATAGCTGCGGGCACTTTGGGTGAGATTCCTCAAGTCCGTCTATGTTTTCTTAGTCTTCAGAAAAAGGAAATGTGTTTTTAATTTAATAATAAGGCATGTTCTATTTATTCCCAGCATTCCCTGGCTCTCCTGCTCCTCCTAAAGTGGTCAGTGCCTTTAAAGACTGTGTTAATTTGGCCTGGCTTCCTCCCTCCAACACTGTAGGAGGCAGTATCATTGGCTACAATGTGGAAAAA[C/T]GAAAAAAGGGCAGCAATTTTTGGAGTCAAGCAAACCTAAAAGATGAACCAATCAGAGGTCTTGAACATTTGATTTCTTAAAAAAAATAGTAATTTAAAGGGCTAGTTCACCCAAAAAAATAAAATTACAATACATTTATTCATTTAGCAGACGCTTTTGTCCAAAGCGACTTAAAATTGAGGAGGCATTTAGCGATTCAGTAAGAAGTGGCAATACACACAAGAAGTGCTAATTATACCAAGGAACTGTTTGTGCGTAGAGAATTAAGTGTTAGAAGGGGGAAGTGTTTTTTTTTTTTTTTTGTAGAGAGAAGAATGTTTTTACAGGTGGTTTGTCAAGCCCACTCACTTACGTAAAGCTTAATTCTTAAATGCACAATATTTTTTCACTTACCCCTCATGTGGTTTTAAGTCTTTATGACTTTTTTCTTCTGTTGAGCACACACAAACACACAAAGATATTTTGAAGTACCAAAGGGTTGTGTGAGCGGTAATGGTGGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1823
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114607 Missense 1172 1260 17 18
Genomic Location (Zv9):
Chromosome 6 (position 46680988)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 46741922
GRCz11 6 46743804
KASP Assay ID:
554-1815.1 (used for ordering genotyping assays)
KASP Sequence:
CMGCATGCCTGTATCAAAGACCATAGACTTCCAGGCAGCCCCCAGATTTA[T/C]TGTCCCATTGAAACTCCATGCTKCTCCGCCGGGTTATGAGTGCCACATGA
Long Flanking Sequence:
AATTTACAGAACACTAATTGCAGCGAATTCCTCGGAGAAGCCAGAGATAAGTGTCTTGCTCAAGGGCAGTGATGATAGAAGATCTATGAAACTCTCTTTATGGGTCACCCTTATCCAGGTTTATACCTCTGGGACTTAGTGCTGCTGTCCCTGACATATAGCCACTAAACTAACACCTTGTCTTGTCCTGGAAATGTTGTACCGGTACGTTGACAGCTGCAGTGTAAAGATGGTCTGTTACACTGGCTCTGGATCATTTCTTTGCCAGTGATGGTCTGCACTTCATAATTTGCTCGCATCCCTCCAGCTTTTACTGCACCTTCACTTAGACACTATCATGCTCACAGAAAATTGCACACAAGTTGTTGTTTGCTATACTGTAAGGTAGCCAAAAATAAACTGACAACCACGTTTTTCCATCTCTCTACCATTTTCAGAAAAACACACATACAGCATGCCTGTATCAAAGACCATAGACTTCCAGGCAGCCCCCAGATTTA[T/C]TGTCCCATTGAAACTCCATGCTGCTCCGCCGGGTTATGAGTGCCACATGAGCTGTGCTGTTACCGGCAACCCGACCCCACATATCACCTGGTACCACAACAACATCAGCCTCAACACAAACCCAAACTACTACATCACCAATGTGTGTGGGGTTTGTTCCCTGCTGATCCTGAGGGTTGAACGCAAAGACATTGGAGAGTACAAGGTTGTGGCCGAAAGCCCTCTTGGTCATGATGAGAGCGCCACCAAGCTCATAATCAAAGGTATGACCACTGTTTTAGTACTAACTGAGCTATTTGTGCTTAAAATGATCATTCATTTGACTTAGTCTTTTACTTTTAGCCATTTAACTACATTTTTCTGTTTTCATGTTTTACAGAGTGAAAAAGAATGAATGTCAAAGAACACAGCAGCTGTTTTAAAATGCATTCTCAAAAGTGAAATAATAACTGATGTGATTTTAGGGAATAAATGTTATCACCTGTATGTATTAAATATTC
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461