Busch Lab

ZMP

si:ch1073-179p4.3

Ensembl ID:
ENSDARG00000075923
ZFIN ID:
ZDB-GENE-040914-66
Description:
Novel protein similar to vertebrate thioredoxin reductase 2 (TXNRD2) [Source:UniProtKB/TrEMBL;Acc:B8
Human Orthologue:
TXNRD2
Human Description:
thioredoxin reductase 2 [Source:HGNC Symbol;Acc:18155]
Mouse Orthologue:
Txnrd2
Mouse Description:
thioredoxin reductase 2 Gene [Source:MGI Symbol;Acc:MGI:1347023]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa20364 Essential Splice Site Available for shipment Available now
sa40377 Essential Splice Site, Splice Site Mutation detected in F1 DNA Not yet available
sa8420 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa20364
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110987 Essential Splice Site 130 503 5 17
ENSDART00000133455 Essential Splice Site 143 309 5 11
Genomic Location (Zv9):
Chromosome 5 (position 17117591)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 14846245
GRCz11 5 15346462
KASP Assay ID:
2259-5546.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCATGTTAGGTCTCTAAACTGGGGTCACAGAGTTCAACTACAAGACAAG[T/C]AAGTTTAACCATTAAAACAACATGAACATGAATCTTTTATGGTTTACAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40377
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site, Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110987 Essential Splice Site 178 503 7 17
ENSDART00000133455 Splice Site None 309 None 11
Genomic Location (Zv9):
Chromosome 5 (position 17115797)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 14844451
GRCz11 5 15344668
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAACATTCTGTTAGCTACTGGTGGACGGCCAAAGTACCCTACACATGTAA[G/A]TGTGTGTGTGTGTGCGTGCGTGTGCGCGAGCACCAGTGCAGGCGGGCATC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1389
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110987 Nonsense 428 503 15 17
ENSDART00000133455 None None 309 None 11

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 17019117)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 14814985
GRCz11 5 15315202
KASP Assay ID:
554-1301.1 (used for ordering genotyping assays)
KASP Sequence:
TACAAACCGCTGGAGTTCACTGTGGCTGAGAGAGATGCCACTCAATGCTA[T/A]ATAAAGGTATTTTAARYAATATTTTCTTTAAATATAGGTTTAAGTAATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8420
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110987 Essential Splice Site 463 503 None 17
ENSDART00000133455 None None 309 None 11

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 17015823)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 14811691
GRCz11 5 15311908
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGGGCCGAACGCTGGTGAAGTCACACAGGGCTTTGCTTTGGGCTTCCAG[T/C]ACGTTCCRCACRTCTCTGTAAACTTGCACATGATGMTGGGCTGGAATCAG
Associated Phenotype:
Not determined