Busch Lab

ZMP

si:dkey-53d10.1

Ensembl ID:
ENSDARG00000075919
ZFIN ID:
ZDB-GENE-081104-422
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B0UYT1]
Human Orthologue:
FAM190A
Human Description:
family with sequence similarity 190, member A [Source:HGNC Symbol;Acc:29349]
Mouse Orthologue:
Fam190a
Mouse Description:
family with sequence similarity 190, member A Gene [Source:MGI Symbol;Acc:MGI:3045354]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa7615 Missense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa7615
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108865 None None 514 None 12
ENSDART00000140115 Missense 370 607 2 8
Genomic Location (Zv9):
Chromosome 8 (position 29576060)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 28718786
GRCz11 8 28728018
KASP Assay ID:
554-4217.1 (used for ordering genotyping assays)
KASP Sequence:
AAACRGGAAGATTATCAGGCTTGAGCAAACTGGAGACCAGACCAAGTCAC[C/A]TGAGAAAGCCGCACACAGGTAATGTGTTTTGTTTTTCTATTTTGAATATT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27228
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108865 Nonsense 333 514 4 12
ENSDART00000140115 None None 607 None 8
Genomic Location (Zv9):
Chromosome 8 (position 29577541)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 28720267
GRCz11 8 28729499
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCTTGAAAATCTATCACGTGGTTAAATCATTTTAGATAAGATAACATTT[T/A]ATTGAGAGAAGGCAAAACATTGAAGGGTAAATGAGTTACAACTTGTGTGC
Associated Phenotype:
Not determined