Busch Lab

ZMP

si:dkeyp-87a12.1

Ensembl ID:
ENSDARG00000075917
ZFIN ID:
ZDB-GENE-081104-480
Description:
Novel protein with a Mitochondrial ribosomal protein L51 / S25 / CI-B8 domain [Source:UniProtKB/TrEM
Human Orthologue:
C1orf222
Human Description:
chromosome 1 open reading frame 222 [Source:HGNC Symbol;Acc:27917]
Mouse Orthologues:
2010015L04Rik, AL670227.1
Mouse Descriptions:
RIKEN cDNA 2010015L04 gene (2010015L04Rik), transcript variant 1, mRNA [Source:RefSeq DNA;Acc:NM_177
RIKEN cDNA 2010015L04 gene Gene [Source:MGI Symbol;Acc:MGI:1917130]

Alleles

There are 9 alleles of this gene:

Allele Name Consequence Status Availability
sa5779 Essential Splice Site F2 line generated Not yet available
sa2450 Essential Splice Site F2 line generated Not yet available
sa31688 Essential Splice Site Available for shipment Available now
sa9940 Essential Splice Site Available for shipment Available now
sa30909 Nonsense Mutation detected in F1 DNA Not yet available
sa41311 Nonsense Mutation detected in F1 DNA Not yet available
sa13052 Nonsense Available for shipment Available now
sa34522 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa5779
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109135 Essential Splice Site 50 1555 2 38
ENSDART00000135353 Essential Splice Site 49 1568 3 39
ENSDART00000109135 Essential Splice Site 50 1555 None 38
ENSDART00000135353 Essential Splice Site 49 1568 None 39

The following transcripts of ENSDARG00000075917 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 55301583)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 53326035
GRCz11 8 53204614
KASP Assay ID:
554-3152.1 (used for ordering genotyping assays)
KASP Sequence:
TCTTCAGRTTTGAGGATGGTTTCTCTGATGGTTTCGACAGCTCTGAGTGG[T/C]GAGARATAAAAYAAATGTTCATTATNNNNNNNAATATCGACTTCATAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2450
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109135 Essential Splice Site 50 1555 2 38
ENSDART00000135353 Essential Splice Site 49 1568 3 39
ENSDART00000109135 Essential Splice Site 50 1555 None 38
ENSDART00000135353 Essential Splice Site 49 1568 None 39

The following transcripts of ENSDARG00000075917 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 55301583)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 53326035
GRCz11 8 53204614
KASP Assay ID:
554-3152.1 (used for ordering genotyping assays)
KASP Sequence:
TCTTCAGRTTTGAGGATGGTTTCTCTGATGGTTTCGACAGCTCTGAGTGG[T/C]GAGAAATAAAAYAAATGTTCATTATNNNNNNNAATATCGACTTCATAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31688
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109135 Essential Splice Site 166 1555 6 38
ENSDART00000135353 Essential Splice Site 163 1568 7 39

The following transcripts of ENSDARG00000075917 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 55294783)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 53332835
GRCz11 8 53211414
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGTAAGAAAAGCATTGTTTGCAGTGTGTTATTTTTTTTACCGTGTCTCC[A/G]GGCTGGAGCTGTGTCAGGTGGAGGTAGAACTGGGTCGCTTCTTGGATCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9940
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109135 Essential Splice Site 404 1555 None 38
ENSDART00000135353 Essential Splice Site 401 1568 None 39

The following transcripts of ENSDARG00000075917 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 55291844)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 53335774
GRCz11 8 53214353
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAAACTCCTGCAGGACATACYRTCTTCATCTGAGCATACAAAAAGAGAGG[T/C]GCCAATCACACTGACCATAGATAYGTAGAWMTAACAGGCCATGTAGYACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30909
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109135 Nonsense 659 1555 17 38
ENSDART00000135353 Nonsense 656 1568 18 39
ENSDART00000109135 Nonsense 659 1555 17 38
ENSDART00000135353 Nonsense 656 1568 18 39

The following transcripts of ENSDARG00000075917 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 55282966)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 53344652
GRCz11 8 53223231
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTCAAGCTGATAAATTGTTCTCTTATATTTCTCTGTGCAGGTTTCCGGC[A/T]AAACAGATGTTGAGATGCCCAGCCTGAATGAAGAAAAAGCAGAAATCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41311
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109135 Nonsense 659 1555 17 38
ENSDART00000135353 Nonsense 656 1568 18 39
ENSDART00000109135 Nonsense 659 1555 17 38
ENSDART00000135353 Nonsense 656 1568 18 39

The following transcripts of ENSDARG00000075917 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 55282966)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 53344652
GRCz11 8 53223231
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTCAAGCTGATAAATTGTTCTCTTATATTTCTCTGTGCAGGTTTCCGGC[A/T]AAACAGATGTTGAGATGCCCAGCCTGAATGAAGAAAAAGCAGAAATCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13052
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109135 Nonsense 821 1555 21 38
ENSDART00000135353 Nonsense 834 1568 22 39

The following transcripts of ENSDARG00000075917 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 55279426)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 53348192
GRCz11 8 53226771
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGTGTGTAAAGAGATGAGGAATCACATGTCTATCCAACCGAAAACGGGGT[T/A]AATCCAGGCCAAATCCAGCTTCACTGCTCAGYTGAAGTTTYTGCCCAGGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5513
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109135 Essential Splice Site 925 1555 24 38
ENSDART00000135353 Essential Splice Site 938 1568 25 39

The following transcripts of ENSDARG00000075917 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 55266982)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 53360636
GRCz11 8 53239215
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAATATACTGTGTGTATGTANNNNNNNNNNTATATATATATATANNCTTCTTTCTCTCTA[G/T]TTCATTGATGTCCAGCCTAATGATGGCTTTGGCACGTTACTGCCTTCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34522
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109135 Essential Splice Site 1307 1555 32 38
ENSDART00000135353 Essential Splice Site 1320 1568 33 39

The following transcripts of ENSDARG00000075917 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 55257043)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 53370575
GRCz11 8 53249154
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCGACTTCGACTGGGTTCCTGAAAACGAGAGCACATCACAAGTGTTCAGG[G/A]TACACATAACACCGATGAGAATCTGTATCGGAAGCACAGCAAAACACACG
Associated Phenotype:
Not determined