Busch Lab

ZMP

si:ch73-70k4.1

Ensembl ID:
ENSDARG00000075915
ZFIN ID:
ZDB-GENE-030131-3788
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8JM47]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa7127 Nonsense Mutation detected in F1 DNA Not yet available
sa21244 Nonsense Available for shipment Available now
sa41167 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa7127
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109367 Nonsense 119 574 3 4
ENSDART00000147760 Nonsense 129 176 3 3
Genomic Location (Zv9):
Chromosome 8 (position 18054288)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 17499176
GRCz11 8 17534888
KASP Assay ID:
554-4484.1 (used for ordering genotyping assays)
KASP Sequence:
AGAAATCTCCTGTTCAAACAKTRAGTGACTGGAGATGGTGCAATGGAAAY[A/T]AAGATGTAAATCCACCTCCKGGTCTGCCAGCTCCATCATTCCTTGTTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21244
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109367 Nonsense 180 574 3 4
ENSDART00000147760 None None 176 None 3
Genomic Location (Zv9):
Chromosome 8 (position 18054473)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 17499361
GRCz11 8 17535073
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATCAAGAGAAACATGCATCTTCACCTGATGGAGACAGTGTGCCAGTATG[C/A]AGTACACAAACTACTCAGCAGCGCAAACTAGATGATGGAGTCAACTGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41167
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109367 Nonsense 362 574 3 4
ENSDART00000147760 None None 176 None 3
Genomic Location (Zv9):
Chromosome 8 (position 18055017)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 17499905
GRCz11 8 17535617
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATTAGTACTGGGAACAAAATCTGGAGCAAGTGGATCTGGATTAGTACTG[G/T]GAACAAAATCTGGAGCAAGTGGATCTGGATTAGTACTGGGAGCAAAATCT
Associated Phenotype:
Not determined