Busch Lab

ZMP

ENSDARG00000075905

Ensembl ID:
ENSDARG00000075905
Human Orthologue:
TGFBRAP1
Human Description:
transforming growth factor, beta receptor associated protein 1 [Source:HGNC Symbol;Acc:16836]
Mouse Orthologue:
Tgfbrap1
Mouse Description:
transforming growth factor, beta receptor associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:24474

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa9094 Nonsense Mutation detected in F1 DNA Not yet available
sa14167 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28826
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110272 Essential Splice Site 167 456 3 7
Genomic Location (Zv9):
Chromosome 17 (position 15431916)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 15582744
GRCz11 17 15590677
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAGATCATCTGGAAATTTGTGGACTGGGTTCTTCGGAGAGACCAAGAGG[C/A]AAGTGTTTAGTGTTAATCAACAGCAGAGGGCAGAGTTATACAGATTTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9094
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110272 Nonsense 317 456 6 7
Genomic Location (Zv9):
Chromosome 17 (position 15425227)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 15576055
GRCz11 17 15583988
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGAAAGACCAGCAGGCTGCTGAATGCTACTGTTGGAGGACCTCTGCTGGA[C/T]GAGACAAGAAGTTCACGCAGACCATATTTCTCACTYTACTACAAATCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14167
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110272 Nonsense 435 456 7 7
Genomic Location (Zv9):
Chromosome 17 (position 15422353)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 15573181
GRCz11 17 15581114
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTGACAGAGGATGTGTTTGCCATTYATGCCAGAAACGTCTTACTGGAGCC[G/T]AGTTCCTGCGCAGGCCGACAGGAGAGCTGACACACATAACCTGTCATAAT
Associated Phenotype:
Not determined