Busch Lab

ZMP

sall1b

Ensembl ID:
ENSDARG00000075891
ZFIN ID:
ZDB-GENE-020228-3
Description:
Putative spalt protein [Source:UniProtKB/TrEMBL;Acc:Q9DGH2]
Human Orthologue:
SALL1
Human Description:
sal-like 1 (Drosophila) [Source:HGNC Symbol;Acc:10524]
Mouse Orthologue:
Sall1
Mouse Description:
sal-like 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1889585]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa3306 Nonsense F2 line generated Not yet available
sa32545 Nonsense Available for shipment Available now
sa44357 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa3306
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113815 Nonsense 223 1217 3 4
Genomic Location (Zv9):
Chromosome 25 (position 37079085)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 35486701
GRCz11 25 35991640
KASP Assay ID:
554-3046.1 (used for ordering genotyping assays)
KASP Sequence:
CCAAAAAGGTTGATTTGGGTTTRATCGAGCAGCTGTTAGCATTGCAACAA[C/T]AGCAGATGCAACAGCTAAAACTAATTGAAGAAATACGCGCCCAAATAATG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30311
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113815 Nonsense 250 1217 3 4
Genomic Location (Zv9):
Chromosome 25 (position 37079003)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 35486619
GRCz11 25 35991558
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATACGCGCCCAAATAATGCTATTAGCAACTCAAAACTCTAAAACACCTT[T/A]GACCACAAACTCCAATGGTTTGTCTCAAACCAGATCACTGATAAAACTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32545
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113815 Nonsense 550 1217 3 4
Genomic Location (Zv9):
Chromosome 25 (position 37078103)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 35485719
GRCz11 25 35990658
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCTTTGCCAGGTCTTCCAGTCATTATCAAAAAAGAGGAGGAAGGGGTAT[C/A]GATAACCAAACCTCATAGTCCTGTTGTCAGTGAGCTAACTAAGAGAATTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1847
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113815 Nonsense 651 1217 3 4
Genomic Location (Zv9):
Chromosome 25 (position 37077801)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 35485417
GRCz11 25 35990356
KASP Assay ID:
554-1838.1 (used for ordering genotyping assays)
KASP Sequence:
TGGGAAGTCTTCCAAATCCYCTTGGAGCATCTGAGACCKCAAAGCTGGAG[C/T]AATTGGTGGAGAACATTGACAAGAAGTACACAGACCCCAATGAGTGTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44357
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113815 Nonsense 812 1217 3 4
Genomic Location (Zv9):
Chromosome 25 (position 37077318)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 35484934
GRCz11 25 35989873
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAACAGAAAGTGAATGCTCTTCGCCGGCTTCATCAGTGTTTGCCAGATCA[G/T]AGAGTCAGATCAAGGTTACGAATGTGGAGAATTTGGAGAACACTAGTAAA
Associated Phenotype:
Not determined