Busch Lab

ZMP

SHPRH

Ensembl ID:
ENSDARG00000075884
Description:
SNF2 histone linker PHD RING helicase [Source:HGNC Symbol;Acc:19336]
Human Orthologue:
SHPRH
Human Description:
SNF2 histone linker PHD RING helicase [Source:HGNC Symbol;Acc:19336]
Mouse Orthologue:
Shprh
Mouse Description:
SNF2 histone linker PHD RING helicase Gene [Source:MGI Symbol;Acc:MGI:1917581]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa42868 Nonsense Mutation detected in F1 DNA Not yet available
sa22999 Nonsense Available for shipment Available now
sa36315 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa42868
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112878 Nonsense 328 883 8 21
Genomic Location (Zv9):
Chromosome 17 (position 7405325)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 7408099
GRCz11 17 7565277
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGTGAACTCTGAGGTTTCTGAAGCACATCAAAACCTACAGCCTGTTCTT[C/T]AGCACATTAAAGAACAAAGACGCAAGGTAGACGCTCGGTTATTACATTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22999
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112878 Nonsense 374 883 9 21
Genomic Location (Zv9):
Chromosome 17 (position 7407735)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 7410509
GRCz11 17 7567687
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGATGATCTTGTCAGCCGCATTCAAAATGAGCTTACATGCAGTTATAAA[C/T]AACAAGCCAACAAGCTCTCAATGGCAGACAAGTAATCCAGCATCTCATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36315
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112878 Essential Splice Site 825 883 19 21
Genomic Location (Zv9):
Chromosome 17 (position 7426265)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 7429039
GRCz11 17 7586217
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCCACGAGCTGCAGGCCATAGGAAGAGTGCATCGGATTGGCCAGACCAA[G/A]TAGGAAACAAACCAATTTTCAATCATATGTCCACTTCTATTCATATTGAT
Associated Phenotype:
Not determined