Busch Lab

ZMP

LOC797480

Ensembl ID:
ENSDARG00000075867
Human Orthologue:
MKL1
Human Description:
megakaryoblastic leukemia (translocation) 1 [Source:HGNC Symbol;Acc:14334]
Mouse Orthologue:
Mkl1
Mouse Description:
MKL (megakaryoblastic leukemia)/myocardin-like 1 Gene [Source:MGI Symbol;Acc:MGI:2384495]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa25248 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa20004 Essential Splice Site Available for shipment Available now
sa10921 Nonsense Available for shipment Available now
sa6887 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa25248
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111769 Essential Splice Site 54 1030 2 16
Genomic Location (Zv9):
Chromosome 3 (position 25015955)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 24594166
GRCz11 3 24724714
KASP Assay ID:
554-7894.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAGTTAGTCATTTTACTGCCCTTCATCTTTGAATTCTTGTTTCTTTTTA[G/A]TGCTCCAACTCAAACTTCAGCAGAGGCGAACTCGAGAAGAACTGGTTGAC
Long Flanking Sequence:
GTTTGTACTCTCTTCTCTGTGACTGATAAACTCACTACCGGCTGTCAGAAAGGGCTTGTTTGTGGGGAGAATGAACGAGACGGATCGAGCTGCTCGCCGGGTACTTTATCAACTTGTGTGTTTTCTGTCATGATGCATTTCCTTGCGTTTGTAGCTGCTGAACATGCAGATAATGAGGGTTTAAAATAGTAATGAGGTACACTGAATCATATTATGCATAGTAACTTATTTTTAAAGTTCAGATGCACTTCTGGTGATTTAGACGTTCGTGTATGCCCGTTTGCTTCTCGCTGGCACTCTTATCTTGTTTATATGGTTTTTTTTTGTGTGTATTTATTTCTTGTTGTAGTTGTGCAAAAAAATGAGGTTGATTTAAATCTTAAAGTCAATCTGTCATGGTGCAACCTTTTCAAAGTCTTAAAATAAGTGTTTGTTAACTTAATTCAGAGTTGAGTTAGTCATTTTACTGCCCTTCATCTTTGAATTCTTGTTTCTTTTTA[G/A]TGCTCCAACTCAAACTTCAGCAGAGGCGAACTCGAGAAGAACTGGTTGACCAGGGGATCATGCCACGTAAGAGTCACTCATACTTTCCTATTTGTATTAACTATCAGTAATATTTCAAACTGCAGATCTATCAATCGCTCAATGATCTTGAATATACTGAAGATGTTTGTCCTTCACACAAAGTTGTTCTTGCATGCGGTTTACGGTTTCTATCCTTATGTGAACCAGGTAAAATGTAGACTTGTGGTTAAACTTTAGCATGTATCACTAGTCTCATCCTGTCTAAGATGCTGATTGGGTTTAGTAAACACCATCATAGAGTTAAACTCGCTTCCTTTCGCGTTGTGGTTTTTAAATGAGCATGAAAGGTTGGCCCATTCATTTCAAGACTCTGCTTTTTGAGCTTGGGTCATCACAATTCTGTAAAGAAGTGCTCTTTTTTTAAATATTTAGTTTTTATCTTGTGCTGTTTGTGGATTTATTTCAGGTCAAATGAAAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26060
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111769 Splice Site, Nonsense 94 1030 3 16
Genomic Location (Zv9):
Chromosome 3 (position 25032043)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 24610254
GRCz11 3 24740802
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAAAAGTTCAGCGTCTTTTCATGAGCAGAGACGAAGTTTAGAACGAGCA[C/T]GAGTAAGTTTTCCTATATTTATCAGTCTTCTCAGTGAAGTGTAAATATAT
Long Flanking Sequence:
CACCAATATGTTTCCTGATATGTCAAAAACACACACTTTTACAAGTACTCAGACTGTGAGTTTGCTGGATAAAACAGTTCCTCAGACAGGCCTGTTGAAATGTTAGATTTAGCTTTTGTATGTGTTCCTGGAGAAAAAACATATGCATTTGTAATATGTTGTTTGTGTATCAAGACCTTTAACAAGCGTCTTTTTTTTTTTTTTTTTTGCTTTTTACAAAAATAACATTTTCACCTATCCAAAAAGAAGAAGCTATGAGATATATTTGCACCGCACTGACGCAGAGTGTTGCCTGTGATCTGCACAACGCACACAACAAGTTTCTATTTTAGATTTTGTTTTCTCTCCAATGCTTTCTATTTTCCACAGCCCTCAACTTTACCCAGTTATATTTATAATAACCTGAATGTAAGAGTCATTTCTCTTTGTGTCTTTTTTACCTTCCAGCACTGAAAAGTTCAGCGTCTTTTCATGAGCAGAGACGAAGTTTAGAACGAGCA[C/T]GAGTAAGTTTTCCTATATTTATCAGTCTTCTCAGTGAAGTGTAAATATATATAGCTGTCTTGCTTTACATCTTCTGCTTTCTTGTGTTTCAGACTGAGGACTACCTAAAGAGAAAGATCCGCAGTCGTCCAGAGAGGTCAGAGCTGGTCAGGATGCACATTCTCGAAGGTGAGTGTTTTCATTACTCCCCCTACAGTTCAAACACGCACACACACCCCTCATTGTTTAGATGTTACACACAGTGTTATGCTCATTTGTCAATTTGAAAAATGTACTTCAAAACTATACTAATTCTAACTAAAAAAATGCAAAAGCATTCAAAATATACTTTTAAGTCTATATTTTGTCCAATGTTATCAGTTTGGGTTTGTAGATTTTAGGTTTTATACATATTCTTAAGTGTCGTTTTTTTCTAAATGCACTTTACTACAATTGCTATGGTTAAACAAGGGTTAGATTTGCAAAACCACAGTTAATTTGTAGTTGTAATGGTTGACTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20004
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111769 Essential Splice Site 120 1030 4 16
Genomic Location (Zv9):
Chromosome 3 (position 25032213)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 24610424
GRCz11 3 24740972
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGCAGTCGTCCAGAGAGGTCAGAGCTGGTCAGGATGCACATTCTCGAAGG[T/C]GAGTGTTTTCATTACTCCCCCTACAGTTCAAACACGCACACACACCCCTC
Long Flanking Sequence:
CAAGACCTTTAACAAGCGTCTTTTTTTTTTTTTTTTTTGCTTTTTACAAAAATAACATTTTCACCTATCCAAAAAGAAGAAGCTATGAGATATATTTGCACCGCACTGACGCAGAGTGTTGCCTGTGATCTGCACAACGCACACAACAAGTTTCTATTTTAGATTTTGTTTTCTCTCCAATGCTTTCTATTTTCCACAGCCCTCAACTTTACCCAGTTATATTTATAATAACCTGAATGTAAGAGTCATTTCTCTTTGTGTCTTTTTTACCTTCCAGCACTGAAAAGTTCAGCGTCTTTTCATGAGCAGAGACGAAGTTTAGAACGAGCACGAGTAAGTTTTCCTATATTTATCAGTCTTCTCAGTGAAGTGTAAATATATATAGCTGTCTTGCTTTACATCTTCTGCTTTCTTGTGTTTCAGACTGAGGACTACCTAAAGAGAAAGATCCGCAGTCGTCCAGAGAGGTCAGAGCTGGTCAGGATGCACATTCTCGAAGG[T/C]GAGTGTTTTCATTACTCCCCCTACAGTTCAAACACGCACACACACCCCTCATTGTTTAGATGTTACACACAGTGTTATGCTCATTTGTCAATTTGAAAAATGTACTTCAAAACTATACTAATTCTAACTAAAAAAATGCAAAAGCATTCAAAATATACTTTTAAGTCTATATTTTGTCCAATGTTATCAGTTTGGGTTTGTAGATTTTAGGTTTTATACATATTCTTAAGTGTCGTTTTTTTCTAAATGCACTTTACTACAATTGCTATGGTTAAACAAGGGTTAGATTTGCAAAACCACAGTTAATTTGTAGTTGTAATGGTTGACTTTAGTATTGTTTTATTGTTTATATTGATATCTATATTTTGAATGTTTTTTTATAGAGGGATGTGTTCATACTTTTTTTTTAACCAATTATTTTATTCTACCATTTCTTTTGTTTACAGTTTTGTTTTAGCCGATTGCCAAATTTTCTGAATGACATGGGGATGCATATAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10921
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111769 Nonsense 288 1030 8 16
Genomic Location (Zv9):
Chromosome 3 (position 25040122)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 24618333
GRCz11 3 24748881
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGCTCTAAGAAAGTGAGAGACAATAAACCTAAAGTCAAGAAKCTGAAAKA[T/A]CACCAGTATGTTCCTCCGGATCAGAAAGCKGAGCGTGAGCCYCCGCCTCT
Long Flanking Sequence:
GAATATTCATATTCAATTTAAATAAATATTTTCTAAAGGCAGCTATACAAAATTATATTTTTGCATATTCAGGGAGCAATAATAAATAGGGGAAAGATAATAAAAAAGGATTTTTTTAAAAGGAGCAAAATTGAAGAGAAACAAAAATAAAAAATAAAATTGTCAATTTTTTGCATAAATTTAAATGTGTTATTTTCTATTTCTAAAGATTTTCAGTGAGAATTTTTTTTTTTTAATAATTATGTATGTTTAAGAAATCTGTTTTATGCAAATTCAACAAAATATATTACCTATATTCACTGAGAAATGGATACAAATATTATTTATGTTGAGCACTGTATATATAATTTTTGTTTATTTTATTTTTAACCAGAATGACCATTATTTTAATGCTTGAACTCTTTCTGTCTTTTTCAGAGTGGTAAAGTGAGTAGTGAGCGTCCTGCTCAGCGCTCTAAGAAAGTGAGAGACAATAAACCTAAAGTCAAGAAGCTGAAATA[T/A]CACCAGTATGTTCCTCCGGATCAGAAAGCTGAGCGTGAGCCTCCGCCTCTGCTCGACTCGTCCTACGCTAAACTCCTCTACCAACAGCAGCTCTTCCTCCAGCTACAGATTATCAACCAACAGCAGCAAAACTACAACTACCACACCATCCTGCCAGCTCCACCCAAGTGAGAAATGTCCTGTATTTGTGGAATGTTTATTATATACAATTGAAGTCAAAATTACTAACCCTGTTGTTGTTTTTTTTTCTTTTCTTTTTTAAATATTTCCCAAATTATGTTTAACAGAACAAGGATATTTTCACAGTTTTTTTTTCTTTTGGAGAAAGTCTTTTTTTTTTTTGGCTAGAATAAGAGCAGTTTTCAATTGCTTATAAACATTATAAGGTCAATATTTTTAGCCCCCTTAAGCTGTATTTTTTTTAATTCTCTACAGAACAAACCATCATTATACAATAACTTATTCTAATTACCCTAACTTACCTAGTTAACCTAATTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6887
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111769 Nonsense 668 1030 11 16
Genomic Location (Zv9):
Chromosome 3 (position 25045643)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 24623854
GRCz11 3 24754402
KASP Assay ID:
554-4814.1 (used for ordering genotyping assays)
KASP Sequence:
AGCAGCAGCAGAGGATTGTAATGCGACAGAATCAACGCAACCTGCTGCAA[C/T]AGACACATCAGAGGAAGAGGAAAACACAGAAGCAGCAGAGACAAGTTAGT
Long Flanking Sequence:
GATTTGATTTGACAGTTTGGATCCGTATGGTTTGGACCTCACATTATTAATATGTTTCCTTTTTGTGTGTGTTTTAGGTGAGCTCTCCTCTCACCCAGCTCTCCCTGCAGCCGTCTCCTCCTCTCCCGACCACTGTGTGCATTAAAGAAGAGCCCTGTAGCCAAACATATCAATCCTCCTCCTGCATGCTTTCTCGTTCTGCAGACAAGGACCAGATGCTGCTGGAGAAGGACCGGCGCATTCAGGAGCTCACCAACATGCTTTTGCAGAAGCAGCAGCTAGTTGAGTCCCTGCGTCTGCAGCTGGAGGGGAAACGGGTGCAAGAGCCCAATCCAGTCAAAGAGGCGCTTCCTGCTGCCGTAATTGAGGCTCTTAGAGTCACTGTAAAGGAGGAGGTGATGGAGGTGGTGGAAGACAGTGAGATGGTGACGGAGCCGCAGGTGGAGCTGGAGCAGCAGCAGAGGATTGTAATGCGACAGAATCAACGCAACCTGCTGCAA[C/T]AGACACATCAGAGGAAGAGGAAAACACAGAAGCAGCAGAGACAAGTTAGTGCTGTGCTTTCACAATGTACAGATTCAGACTTGGCATTAATAGTGTGATCATTATTTGATCAGAGATGGGGGTTTAAAGAGTTGGTTTAAGTGCTGATTGATGGAAAGTTATAACTTATTTATAAAGGACCCTCTTTATAAAGCCTAAACAAGGGTTAATGTTGTTAAATAAAAGCAAAACAGTGAAATAAAACACATCTATAAATACAATTAAATGTTATTATTAGATGACACTTTAAATTGATATGACAAATTTTAATCAAATATTTACATATACAGTACTAAAAAAAGTTTAGATTTAAACAATAATAAGCACAAGCTGAAATATTTAAAACTGAATTAAAGCATTAAATACAATTAAATTAAGAACGTAGTGTTTTTATAAATATATTATAAATTTATTCATTTATTTATTATTATATAATAAATAATATAAATTATTCAATTAAT
Associated Phenotype:
Not determined