Busch Lab

ZMP

SORCS3 (1 of 2)

Ensembl ID:
ENSDARG00000075865
Description:
sortilin-related VPS10 domain containing receptor 3 [Source:HGNC Symbol;Acc:16699]
Human Orthologue:
SORCS3
Human Description:
sortilin-related VPS10 domain containing receptor 3 [Source:HGNC Symbol;Acc:16699]
Mouse Orthologue:
Sorcs3
Mouse Description:
sortilin-related VPS10 domain containing receptor 3 Gene [Source:MGI Symbol;Acc:MGI:1913923]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa32759 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa32760 Essential Splice Site Available for shipment Available now
sa18560 Nonsense Available for shipment Available now
sa19576 Essential Splice Site Available for shipment Available now
sa13192 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32759
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110573 Essential Splice Site 236 1039 2 22
Genomic Location (Zv9):
Chromosome 1 (position 48752260)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 47560287
GRCz11 1 48257250
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCTGTATGACTTTCACCTTGGCAGCGTCACAGAGAGCACGCTATGGAGG[T/C]GAGCTAAAGCCACCATTTCTCTCTCTATCTATCTTTCTCTCTCTCTCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32760
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110573 Essential Splice Site 236 1039 3 22
Genomic Location (Zv9):
Chromosome 1 (position 48800341)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 47616143
GRCz11 1 48304469
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAAACAAAACATCTCCTGAATGGCATATTGAGAGTGTTGCTTCTATTTCC[A/T]GATCCACGGATTATGGCAGCACTTATGAGAGGCTGAATGATAAAGTGGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18560
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110573 Nonsense 747 1039 16 22
Genomic Location (Zv9):
Chromosome 1 (position 48928301)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149942.1 7753
GRCz11 1 48424388
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGGRAATTATTGTATGGTGGGATGGGACAACTCTAGGATCCTGTCTGCT[G/T]ARCCCTGCATATGCAGAGCACATGACTTTGAGTGGTGAGTTAACCAACGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19576
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110573 Essential Splice Site 758 1039 17 22
Genomic Location (Zv9):
Chromosome 1 (position 48942901)
KASP Assay ID:
2259-1049.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCCTCTTTTGC[A/T]GTGATTATGGTTTTGAGAGGAGAGGGGATGGAAACTGTCTGCCGGCGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13192
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110573 Nonsense 775 1039 17 22
Genomic Location (Zv9):
Chromosome 1 (position 48942953)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 47747288
GRCz11 1 48438172
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGATTATGGTTTTGAGAGGAGAGGRGATGGAAACTGTCTGCCGGCRTTTT[G/A]GTTCAACCCTTCTATAGTGTCTCGAAGCTGCAGCCAAGGGCAAAACTTCC
Associated Phenotype:
Not determined