Busch Lab

ZMP

si:ch211-136o4.1

Ensembl ID:
ENSDARG00000075864
ZFIN ID:
ZDB-GENE-060503-288
Description:
cDNA, clone cssl:d0672 [Source:UniProtKB/TrEMBL;Acc:B0CLZ6]
Human Orthologue:
IGSF9
Human Description:
immunoglobulin superfamily, member 9 [Source:HGNC Symbol;Acc:18132]
Mouse Orthologue:
Igsf9
Mouse Description:
immunoglobulin superfamily, member 9 Gene [Source:MGI Symbol;Acc:MGI:2135283]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa10840 Essential Splice Site Available for shipment Available now
sa17448 Essential Splice Site Available for shipment Available now
sa21707 Essential Splice Site Available for shipment Available now
sa24866 Nonsense Mutation detected in F1 DNA Not yet available
sa34879 Nonsense Mutation detected in F1 DNA Not yet available
sa17395 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10840
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111952 Essential Splice Site 20 1619 None 21
ENSDART00000137456 Essential Splice Site 20 767 None 17
Genomic Location (Zv9):
Chromosome 10 (position 19069813)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 19082159
GRCz11 10 19039593
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAGAACCTTCCTCTGTTGGAAGTCATTGTTGCAGTTCTGTGCCTATTCAG[T/A]GAGTATTTTACAGTATCTACTTCACAACTGACAGATGCACAATCATGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17448
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111952 Essential Splice Site 84 1619 2 21
ENSDART00000137456 Essential Splice Site 84 767 3 17
Genomic Location (Zv9):
Chromosome 10 (position 19072556)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 19084902
GRCz11 10 19042336
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATCTTCATGCAGCTCGGAGTTCATCCTCGAGTACATCCTGACTATGATGG[T/C]AAGAACGTCTAACTTATGATGTATTTRAYACTATGTTATTATTATTAWTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21707
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111952 Essential Splice Site 184 1619 4 21
ENSDART00000137456 Essential Splice Site 184 767 5 17
Genomic Location (Zv9):
Chromosome 10 (position 19090615)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 19102961
GRCz11 10 19060395
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACCTGGTCCAAAGACGGAGCACCAATAAAACCTCAACACAAAGTAAAGG[T/G]CAGAATGAAGCACTTTAAAACCTTACGAAATACTGAACAGCTGCGATTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24866
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111952 Nonsense 346 1619 8 21
ENSDART00000137456 Nonsense 346 767 9 17
Genomic Location (Zv9):
Chromosome 10 (position 19101411)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 19113757
GRCz11 10 19071191
KASP Assay ID:
554-7599.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACTGACCTTCCTCCCCACTGGCATGAGGGGTGCGATTGTGTGCCCTGTC[C/T]GAGCTGAACCTCCATTATCACACATCGACTGGATCAAAGACGGCAAACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34879
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111952 Nonsense 745 1619 16 21
ENSDART00000137456 Nonsense 752 767 17 17
Genomic Location (Zv9):
Chromosome 10 (position 19113156)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 19125502
GRCz11 10 19082936
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGAGTGGGACTCCTTTGCCTCGTTCTTGTCCTGACCTTGGCGATAGCTTG[T/A]TTCATTTCTTACAAAAGAAGCAGAAGGCGCAGGCAGAATATTAAGGGTAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27589
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111952 Nonsense 882 1619 18 21
ENSDART00000137456 None None 767 None 17
Genomic Location (Zv9):
Chromosome 10 (position 19113826)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 19126172
GRCz11 10 19083606
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTCAGTTCTCAAATTAAAAGAAACCCAAATCAGAATTCCCATCAGGCAT[C/A]AGATGGAAGCAGGAGCTTCAGAATACAGAAATCCCAGTCTTTGAGATCCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4368
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111952 Nonsense 1136 1619 18 21
ENSDART00000137456 None None 767 None 17
Genomic Location (Zv9):
Chromosome 10 (position 19114588)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 19126934
GRCz11 10 19084368
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCAACGGTCTCGAAGTTTAGACAGAGAGGAACATCGAAAATCACATACAT[G/A]GGACCAAAGACGAAGCAAGACACCTGTTGAATCAAGTCGGTATTGTGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17395
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111952 Nonsense 1566 1619 19 21
ENSDART00000137456 None None 767 None 17
Genomic Location (Zv9):
Chromosome 10 (position 19116163)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 19128509
GRCz11 10 19085943
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGCAGARCAGCATTACTAAAGATGATGACAGTWCAAATTTAGACCAAAAA[C/T]AAMAAGGTAAGAAAAATGWTAGCCTTGTATGTTGTAACACTAAGGGCTCT
Associated Phenotype:
Not determined