Busch Lab

ZMP

si:dkey-269p14.1

Ensembl ID:
ENSDARG00000075859
ZFIN ID:
ZDB-GENE-090312-122
Description:
Novel protein similar to vertebrate MCF.2 cell line derived transforming sequence-like (MCF2L) [Sour
Human Orthologue:
MCF2L
Human Description:
MCF.2 cell line derived transforming sequence-like [Source:HGNC Symbol;Acc:14576]
Mouse Orthologue:
Mcf2l
Mouse Description:
mcf.2 transforming sequence-like Gene [Source:MGI Symbol;Acc:MGI:103263]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa32745 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa18705 Nonsense Mutation detected in F1 DNA Not yet available
sa9961 Nonsense Available for shipment Available now
sa31232 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa32745
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114083 Essential Splice Site 121 1166 4 31
ENSDART00000144821 None None 213 None 7

The following transcripts of ENSDARG00000075859 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 47032386)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 45844047
GRCz11 1 46535279
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCGGCAAGACAGATGGGCATCAGTGAAGGGGACACTGCTGCGGATCGCGG[T/C]GAGTCCTCCGTGTGTGTGTTTGTGTGTGAAAGAGAGAGAGATGGGATGTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa6603
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114083 Nonsense 692 1166 19 31
ENSDART00000144821 None None 213 None 7

The following transcripts of ENSDARG00000075859 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 47073737)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 45885398
GRCz11 1 46576630
KASP Assay ID:
554-5402.1 (used for ordering genotyping assays)
KASP Sequence:
TGCTCCTCTTTTCCTCAGWTGACAGAKCTGCWGATTTATGAGAAGTACTG[T/A]CAGAACAAACCTCGCTCAGAGTCTTTATGGAGACAGTGCTCTGACTGCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18705
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114083 Nonsense 704 1166 19 31
ENSDART00000144821 None None 213 None 7
ENSDART00000114083 Nonsense 704 1166 19 31
ENSDART00000144821 None None 213 None 7

The following transcripts of ENSDARG00000075859 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 47073771)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 45885432
GRCz11 1 46576664
KASP Assay ID:
2259-0994.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTATGAGAAGTACTGTCAGAACAAACCTCGCTCAGAGTCTTTATGGAGA[C/T]AGTGCTCTGACTGCGCTTTCTTCCAGGTCTTCTTACTTTTTATATGCGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9961
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114083 Nonsense 704 1166 19 31
ENSDART00000144821 None None 213 None 7
ENSDART00000114083 Nonsense 704 1166 19 31
ENSDART00000144821 None None 213 None 7

The following transcripts of ENSDARG00000075859 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 47073771)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 45885432
GRCz11 1 46576664
KASP Assay ID:
2259-0994.1 (used for ordering genotyping assays)
KASP Sequence:
TTTATGAGAAGTACTGWCAGAACAAACCTCGCTCAGAGTCTTTATGGAGA[C/T]AGTGCTCTGACTGCGCTTTCTTCCAGGTCTTCTTACTTTTTATATGCGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31232
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114083 Essential Splice Site 743 1166 20 31
ENSDART00000144821 None None 213 None 7

The following transcripts of ENSDARG00000075859 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 47075579)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 45887240
GRCz11 1 46578472
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCTGCTGAAACCTGTGCAGAGAATAACCAAATACCAGCTTTTACTAAAG[G/A]TAAACTACACGGTCGCCTCTCACTGATGTAGGTACAGATATATTGCAGTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4863
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114083 Nonsense 805 1166 22 31
ENSDART00000144821 None None 213 None 7

The following transcripts of ENSDARG00000075859 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 47076867)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 45888528
GRCz11 1 46579760
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCAGTGATCTGGGCCGTCTGATGATGCAGGGCTCCTTCAGCGTGTGGACG[G/T]AGCATAAGAAGGGTCACGCCAAGGTAAAAGACCTGGCRCGATTCAAGCCC
Associated Phenotype:
Not determined