Busch Lab

ZMP

si:dkey-108d10.1

Ensembl ID:
ENSDARG00000075853
ZFIN ID:
ZDB-GENE-091204-186
Human Orthologue:
SH3KBP1
Human Description:
SH3-domain kinase binding protein 1 [Source:HGNC Symbol;Acc:13867]
Mouse Orthologue:
Sh3kbp1
Mouse Description:
SH3-domain kinase binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1889583]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa16738 Essential Splice Site Available for shipment Available now
sa12980 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30110
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109809 Splice Site None 634 None 18
ENSDART00000143395 Nonsense 208 669 6 18
Genomic Location (Zv9):
Chromosome 24 (position 26671589)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 25729946
GRCz11 24 25874987
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCATGCAAATCCCCATGCAAATGCTCAGATCCTCCTGTGAAATGTGTGTG[T/A]GCAGGTATAAAGGACAGCACCGGCTCAGAGAGCGATGGCGGCGACTCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16738
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109809 Essential Splice Site 530 634 16 18
ENSDART00000143395 Essential Splice Site 565 669 16 18
Genomic Location (Zv9):
Chromosome 24 (position 26696842)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 25755199
GRCz11 24 25900240
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCTTCGTGYTCAATGAACTGTTGCGCTGATGTCTCATGGGGGTTTTCCAC[A/T]GGTTCCYGAGAAATCATCTTTACCTCCTAAGCCCAGCGGTGTATCATCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12980
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109809 Nonsense 565 634 16 18
ENSDART00000143395 Nonsense 600 669 16 18
Genomic Location (Zv9):
Chromosome 24 (position 26696950)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 25755307
GRCz11 24 25900348
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATCGTCRTCTCTCCACCAGGGCGGCGCTGGACTGCGGCCTCATTCGCCTT[C/A]RGTTGATGCCAGAGGGAAGAGCGAACAGGGTCCCGTCACGCTGGAGGAGC
Associated Phenotype:
Not determined